KIAA2012

Gene/Protein Characteristic Table for KIAA2012

Order Kazusa clone(s) from :

Product ID	ORK05744
Accession No	AB095932
Description	KIAA2012
Clone name	ah04096
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5133 bp) Predicted protein sequence (555 aa)
Source	Human brain (amygdala)

Features of the cloned cDNA sequence

Description

Length: 5133 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	812 bp
Genome contig ID	gi89161199f_202608684
PolyA signal sequence (None)	+--------+--------+----*----+---- CACTCCAGCCTGGGTGACAGAGCAAGACTCTCTTT
Flanking genome sequence (162148 - 162197)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAAAAAAAGGCAGGGGCTGCCGGGTGCAGTGGCTCATG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	2	f	202708684	202770830	10	99.2	Perfect prediction

Features of the protein sequence

Description

Length: 555 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
EAW70301	9.6e-61	88.6	hCG1776789, iso...	Homo sapiens
NP_001013793	2.2e-58	58.7	hypothetical pr...	Mus musculus
XP_576575	3.3e-53	56.7	hypothetical pr...	Rattus norvegicus
EDL98950	3.6e-29	78.5	rCG22344 [Rattu...	Rattus norvegicus
EDL00132	5.2e-29	78.0	mCG142695 [Mus ...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Expression profile

Description

RT-PCR-ELISA

Experimental conditions

Primer_f	AAGAATTTTACACGCGCAAGC
Primer_r	ATATCTGCTTCTGGGGTCTGG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information

Description

Chromosome No. 2

Experimental conditions

Panel name	genbank
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-

Order Kazusa clone(s) from :

Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp