Order Kazusa clone(s) from :
Japan
||
Other countries |
Product ID | ORK04177 |
---|---|
Accession No | AK024430 |
Clone name | as00019 |
Vector information | |
cDNA sequence | DNA sequence (4165 bp) Predicted protein sequence (732 aa) |
Source | Human spleen |
Rouge ID |
mFLJ00019
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | Warning |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.Result of homology search against other entries from Kazusa human cDNA project (FASTA output, Multiple alignment)
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR000225 | 149 | 190 | PF00514 | Armadillo |
IPR000225 | 233 | 274 | PF00514 | Armadillo | |
HMMSmart | IPR000225 | 148 | 190 | SM00185 | Armadillo |
IPR000225 | 191 | 232 | SM00185 | Armadillo | |
IPR000225 | 233 | 274 | SM00185 | Armadillo | |
IPR000225 | 317 | 364 | SM00185 | Armadillo | |
IPR000225 | 365 | 410 | SM00185 | Armadillo | |
ProfileScan | IPR000225 | 202 | 245 | PS50176 | Armadillo |
IPR000694 | 476 | 685 | PS50099 | Proline-rich region |
RT-PCR-ELISA |
Primer_f | TGTGTGCCTCCTATGTCGTGA |
---|---|
Primer_r | TCATACAGAAACCCCACAAGG |
PCR conditions | 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles |