Gene/Protein Characteristic Table for FLJ00019
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK04177
Accession No AK024430
Clone name as00019
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (4165 bp)
Predicted protein sequence (732 aa)
Source Human spleen
Rouge ID mFLJ00019 by Kazusa Mouse cDNA Project
Features of the cloned cDNA sequence
Description

Length: 4165 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq Warning Warning
Features of the protein sequence
Description

Length: 732 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAB15720 0 100.0 FLJ00019 protei...
Homo sapiens
EAW52133 0 99.7 armadillo repea...
Homo sapiens
AAO45101 0 99.9 FLJ00019-like p...
Homo sapiens
BAG57988 1.7e-194 93.3 unnamed protein...
Homo sapiens
BAG58611 2.4e-194 93.3 unnamed protein...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against other entries from Kazusa human cDNA project (FASTA output, Multiple alignment)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR000225 149 190 PF00514 Armadillo
IPR000225 233 274 PF00514 Armadillo
HMMSmart IPR000225 148 190 SM00185 Armadillo
IPR000225 191 232 SM00185 Armadillo
IPR000225 233 274 SM00185 Armadillo
IPR000225 317 364 SM00185 Armadillo
IPR000225 365 410 SM00185 Armadillo
ProfileScan IPR000225 202 245 PS50176 Armadillo
IPR000694 476 685 PS50099 Proline-rich region
Expression profile
Description

RT-PCR-ELISA
Experimental conditions
Primer_f TGTGTGCCTCCTATGTCGTGA
Primer_r TCATACAGAAACCCCACAAGG
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the NEDO Protein Database homepage
Send a message to office AT kazusa.or.jp