Gene/Protein Characteristic Table for FLJ00022
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK05038
Accession No AK024432
Clone name as00022
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (4815 bp)
Predicted protein sequence (344 aa)
Source Human spleen
Rouge ID mFLJ00022 by Kazusa Mouse cDNA Project
Features of the cloned cDNA sequence
Description

Length: 4815 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq No warning Warning
Features of the protein sequence
Description

Length: 344 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAB15722 1.5e-119 100.0 FLJ00022 protei...
Homo sapiens
XP_001141271 1.7e-119 100.0 similar to FLJ0...
Pan troglodytes
XP_342421 1.2e-112 95.9 similar to C06A...
Rattus norvegicus
BAD21363 1.7e-112 95.6 mFLJ00022 prote...
Mus musculus
Q9H7P6 1.1e-109 100.0 Multivesicular ...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against other entries from Kazusa human cDNA project (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
AK024441 1.7e-38 100.0 FLJ00031
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
ProfileScan IPR000694 38 48 PS50099 Proline-rich region
Expression profile
Description

RT-PCR-ELISA
Experimental conditions
Primer_f ATGGATGGGGTGCCTTTTATG
Primer_r CTCTGTGCGGAAGCTGTACTC
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the NEDO Protein Database homepage
Send a message to office AT kazusa.or.jp