Gene/Protein Characteristic Table for FLJ00062
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK05057
Accession No AK024469
Clone name as00062
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (4264 bp)
Predicted protein sequence (484 aa)
Source Human spleen
Rouge ID mFLJ00062 by Kazusa Mouse cDNA Project
Features of the cloned cDNA sequence
Description

Length: 4264 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq Warning Warning
Features of the protein sequence
Description

Length: 484 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAB15759 3.5e-215 100.0 FLJ00062 protei...
Homo sapiens
EAW57954 1e-212 99.8 histone deacety...
Homo sapiens
AAH06453 1.7e-189 94.2 HDAC7 protein [...
Homo sapiens
AAP88773 1.9e-189 94.2 histone deacety...
Homo sapiens
EAW57955 2.1e-189 94.2 histone deacety...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against other entries from Kazusa human cDNA project (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
AB006626 9.8e-130 68.8 KIAA0288
AK122588 3.1e-110 99.6 FLJ00413
AB011172 2.1e-92 63.0 KIAA0600
AB020708 2.2e-40 44.3 KIAA0901
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
FPrintScan IPR000286 198 221 PR01270 Histone deacetylase superfamily
IPR000286 232 247 PR01270 Histone deacetylase superfamily
IPR000286 323 333 PR01270 Histone deacetylase superfamily
HMMPfam IPR000286 51 397 PF00850 Histone deacetylase superfamily
Expression profile
Description

RT-PCR-ELISA
Experimental conditions
Primer_f ATCCGGGTGCACAGTAAATAC
Primer_r GATGGTTCCAGAGCCTTAGAG
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the NEDO Protein Database homepage
Send a message to office AT kazusa.or.jp