Gene/Protein Characteristic Table for FLJ00109
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK05079
Accession No AK024500
Clone name as00109
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (4407 bp)
Predicted protein sequence (332 aa)
Source Human spleen
Features of the cloned cDNA sequence
Description

Length: 4407 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq No warning Warning
Features of the protein sequence
Description

Length: 332 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAB15790 4.8e-106 100.0 FLJ00109 protei...
Homo sapiens
EAW48340 8.1e-93 94.7 microtubule ass...
Homo sapiens
EAW48341 1.4e-92 94.7 microtubule ass...
Homo sapiens
AAH52983 1.5e-92 94.7 Microtubule ass...
Homo sapiens
Q8TDZ2 1.5e-92 94.7 NEDD9-interacti...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against other entries from Kazusa human cDNA project (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
AK160384 5.8e-60 94.4 FLJ00407
AB020626 6.7e-08 30.8 KIAA0819
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile
Description

RT-PCR-ELISA
Experimental conditions
Primer_f ATGATCACGGTGCAGGAATTG
Primer_r TGACCAAATCCACCAGCTTCC
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the NEDO Protein Database homepage
Send a message to office AT kazusa.or.jp