KIAA2002

Product ID	ORK06807
Accession No	AB082533
Description	pseudopodium-enriched atypical kinase 1
Clone name	bf00111
Vector information	The cDNA fragment was inserted at the XhoI-SacI site of the ... The cDNA fragment was inserted at the XhoI-SacI site of the pBC SK+ vector(Cm resistance; http://www.kazusa.or.jp/huge/vectorinfo/pbcskp_s.txt) with sequences including attB1 and attB2 sites (CTCGAGCAGC TGAAGCTTTC ACAAGTTTGT ACAAAAAAGC AGGCTCTTC-5' end of cDNA, GAGCTCTCAC CACTTTGTAC AAGAAAGCTG GGCGGCCGCT TTTTTTTTTT TTTTTTT-3' end of cDNA).
cDNA sequence	DNA sequence (8282 bp) Predicted protein sequence (764 aa)
Source	Human adult brain
Rouge ID	mKIAA2002 by Kazusa Mouse cDNA Project

Length: 8282 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	5986 bp
Genome contig ID	gi51511731r_75087561
PolyA signal sequence (AATAAA,-24)	+--------+--------+----*----+---- GTTACTGTGTAAATAAATTCATTTTAATACACACT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAAAACAGACAAATGCTTGTCCTTTTGGCGACTCTTCCACACTGACATG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	15	r	75187561	75258378	4	99.1	Perfect prediction

Length: 764 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
NP_079052	100.0	NKF3 kinase fam...	Homo sapiens
Q9H792	99.9	Tyrosine-protei...	Homo sapiens
XP_510688	99.6	hypothetical pr...	Pan troglodytes
XP_001106139	98.4	hypothetical pr...	Macaca mulatta
XP_001927100	91.6	similar to Tyro...	Sus scrofa

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR000719	530	678	PD000001	Protein kinase
HMMPfam	IPR000719	363	681	PF00069	Protein kinase
HMMSmart	IPR002290	362	684	SM00220	Serine/threonine protein kinase
ProfileScan	IPR000719	331	693	PS50011	Protein kinase
ScanRegExp	IPR008266	530	542	PS00109	Tyrosine protein kinase

Primer_f	GGCATGAGGCAAATACAGAAG
Primer_r	GAGAGGACCTTTCAATGATAG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	genbank
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-