KIAA1843

Product ID	ORK05721
Accession No	AB058746
Description	unc-80 homolog (C. elegans)
Clone name	bf02364
Vector information	The cDNA fragment was inserted at the XhoI-SacI site of the ... The cDNA fragment was inserted at the XhoI-SacI site of the pBC SK+ vector(Cm resistance; http://www.kazusa.or.jp/huge/vectorinfo/pbcskp_s.txt) with sequences including attB1 and attB2 sites (CTCGAGCAGC TGAAGCTTTC ACAAGTTTGT ACAAAAAAGC AGGCTCTTC-5' end of cDNA, GAGCTCTCAC CACTTTGTAC AAGAAAGCTG GGCGGCCGCT TTTTTTTTTT TTTTTTT-3' end of cDNA).
cDNA sequence	DNA sequence (8010 bp) Predicted protein sequence (1778 aa)
Source	Human adult brain
Rouge ID	mKIAA1843 by Kazusa Mouse cDNA Project
Note	We replaced pj01248, former representative clones for KIAA1843 with bf02364. (2002/5/10)

Length: 8010 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	2673 bp
Genome contig ID	gi89161199f_210302198
PolyA signal sequence (None)	+--------+--------+----*----+---- CACTATGAGTTGGCCAGTCTAGGATTTATGTGAAG
Flanking genome sequence (241087 - 241136)	----+--------+--------+--------+--------+----* AAAAAAAAATTTAATTGTTTATGTAATATCTAGAGTCTGGTCCTGACAAG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	2	f	210402198	210543283	37	99.6	Perfect prediction

Length: 1778 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAW70470	100.0	chromosome 2 op...	Homo sapiens
EAW70465	100.0	chromosome 2 op...	Homo sapiens
EAW70467	100.0	chromosome 2 op...	Homo sapiens
NP_115893	100.0	chromosome 2 op...	Homo sapiens
XP_001102174	99.5	similar to CG18...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Primer_f	CCATCGAATTTGCCTGTCACC
Primer_r	AATATGTCGGTGGTCTCTCCC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Chromosome No. 2

Experimental conditions

Panel name	CCR
Primer_f	CCATCGAATTTGCCTGTCACC
Primer_r	AATATGTCGGTGGTCTCTCCC
PCR product length	95 bp
PCR conditions	15 °C66 sec60 °C30 sec187(1.6k) cycles