|
Order Kazusa clone(s) from : |
| Product ID | ORK04022 |
|---|---|
| Accession No | AB082527 |
| Description | acyl-CoA binding domain containing 5, transcript variant 3 |
| Clone name | bj00079 |
| Vector information | |
| cDNA sequence | DNA sequence (3682 bp) Predicted protein sequence (437 aa) |
|
HaloTag ORF Clone |
FHC04022
|
| Flexi ORF Clone | FXC04022 |
| Source | Human adult brain |
| Rouge ID |
mKIAA1996
by Kazusa Mouse cDNA Project
|
Length: 3682 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).
| N-terminal truncation | Coding interruption | |
|---|---|---|
| cloned DNA seq | No warning | No warning |
Integrity of 3' end
| Length of 3'UTR | 2210 bp |
|---|---|
| Genome contig ID | gi89161187r_27424155 |
| PolyA signal sequence (AATAAA,-17) |
+----*----+----*----+----*----+---- |
| Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
| Chr | f/r | start | end | exon | identity | class | |
|---|---|---|---|---|---|---|---|
|
| 10 | r | 27524155 | 27571023 | 12 | 99.3 | Perfect prediction |
Length: 437 aa
Result of homology search against nr database
(FASTA output,
Multiple alignment)![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database
(FASTA output,
Multiple alignment)
Result of motif / domain search (InterProScan and SOSUI)
Result of InterProScan
| Search method | interpro_ID | From | To | Entry | Definition |
|---|---|---|---|---|---|
| BlastProDom | IPR000582 | 6 | 37 | PD351532 | Acyl-coA-binding protein |
| HMMPfam | IPR000582 | 13 | 43 | PF00887 | Acyl-coA-binding protein |
| ProfileScan | IPR000582 | 1 | 44 | PS51228 | Acyl-coA-binding protein |
Prediction of transmembrane (TM) segments| Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 405 | EMSPGVLTFAIIWPFIAQWLVYL | 427 | PRIMARY | 23 |
|---|
RT-PCR-ELISA
|
Experimental conditions| Primer_f | TATCTTAGTCACGGAGTTGCC |
|---|---|
| Primer_r | ATCAGTGGGTTATGTCTAGCC |
| PCR conditions | 95 °C 30 sec 55 °C 30 sec 72 °C 60 sec 30 cycles![]() |
Chromosome No. 10
Experimental conditions| Panel name | genbank |
|---|---|
| Primer_f | - |
| Primer_r | - |
| PCR product length | - |
| PCR conditions | - |