Gene/Protein Characteristic Table for KIAA2001
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK01188
Accession No AB082532
Description retrotransposon gag domain containing 4
Clone name bj00176
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
cDNA sequence DNA sequence (4356 bp)
Predicted protein sequence (689 aa)
Flexi ORF Clone FXC01188
Source Human adult brain
Rouge ID mKIAA2001 by Kazusa Mouse cDNA Project
Features of the cloned cDNA sequence
Description

Length: 4356 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq Warning Warning
Integrity of 3' end
Length of 3'UTR 2285 bp
Genome contig ID gi89161218r_71163688
PolyA signal sequence
(AATAAA,-22)
+----*----+----*----+----*----+----
GCTTTCTCTCCTCAATAAAAATATAAAGGGTGTGT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAAGATTGTGCCTCTTTGTTATTGAGCAAGCATAGATGGGTACAGAGTAG
Features of the protein sequence
Description

Length: 689 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
XP_549073 2.6e-115 78.4 similar to retr...
Canis lupus fam...
BAB46855 1e-95 96.3 hypothetical pr...
Macaca fascicularis
CAB94872 6.8e-92 100.0 hypothetical pr...
Homo sapiens
Q5DTT4 3.4e-76 66.3 Retrotransposon...
Mus musculus
EDL95878 3.4e-60 66.4 rCG36266 [Rattu...
Rattus norvegicus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR005162 309 402 PF03732 Retrotransposon gag protein
Expression profile
Description

RT-PCR-ELISA
Experimental conditions
Primer_f GACTTCTAGGTACAAACTCAG
Primer_r TGCAGAAAGTCCAGTGTCCAG
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. X
Experimental conditions
Panel name unigene
Primer_f -
Primer_r -
PCR product length -
PCR conditions -
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp