Order Kazusa clone(s) from : 
Japan
||
Other countries |
|
Order Kazusa clone(s) from :
Japan
||
Other countries |
| Product ID | ORK00048 |
|---|---|
| Accession No | AB002308 |
| Description | SEC16 homolog A, endoplasmic reticulum export factor, transcript variant 1 |
| Clone name | ee03470 |
| Vector information |
The cDNA fragment was inserted at the XhoI-SacI site of the ...
|
| cDNA sequence | DNA sequence (9031 bp) Predicted protein sequence (2388 aa) |
|
HaloTag ORF Clone |
FHC00048
|
| Flexi ORF Clone | FXC00048 |
| Source | |
| Rouge ID |
mKIAA0310
by Kazusa Mouse cDNA Project
|
| Note | We replaced hg00111 and hg00111s1, former representative clones for KIAA0310 with ee03470. (2002/5/10,2005/08/06) |
Length: 9031 bp Physical map
Restriction map Prediction of protein coding region (GeneMark analysis).
| N-terminal truncation | Coding interruption | |
|---|---|---|
| cloned DNA seq | No warning | Warning |
Integrity of 3' end
| Length of 3'UTR | 1648 bp |
|---|---|
| Genome contig ID | gi89161216r_138354380 |
| PolyA signal sequence (AATAAA,-23) |
+----*----+----*----+----*----+---- |
| Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
| Chr | f/r | start | end | exon | identity | class | |
|---|---|---|---|---|---|---|---|
|
| 9 | r | 138454380 | 138497328 | 32 | 100.0 | Perfect prediction |
Length: 2388 aa
Result of homology search against nr database
(FASTA output,
Multiple alignment) |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database
(FASTA output,
Multiple alignment)The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
|
RT-PCR
|
|---|
Experimental conditions| Primer_f | GAATCAAAAGTCGTGGCAGTC |
|---|---|
| Primer_r | TCCATTTGTCCTTGTCACTTG |
| PCR conditions | 95 °C 30 sec55 °C30 sec72 °C60 sec30 cycles |
Chromosome No. 9 Experimental conditions| Panel name | GeneBridge 4 |
|---|---|
| Primer_f | GAATCAAAAGTCGTGGCAGTC |
| Primer_r | TCCATTTGTCCTTGTCACTTG |
| PCR product length | 146 bp |
| PCR conditions | 95 °C15 sec62 °C60 sec30 cycles |
Japan
||
Other countries
