KIAA2030

Product ID	ORK05749
Accession No	AB107352
Description	ubinuclein 2
Clone name	ef00583
Vector information	The cDNA fragment was inserted at the XhoI-SacI site of the ... The cDNA fragment was inserted at the XhoI-SacI site of the pBC SK+ vector(Cm resistance; http://www.kazusa.or.jp/huge/vectorinfo/pbcskp_s.txt) with sequences including attB1 and attB2 sites (CTCGAGCAGC TGAAGCTTTC ACAAGTTTGT ACAAAAAAGC AGGCTCTTC-5' end of cDNA, GAGCTCTCAC CACTTTGTAC AAGAAAGCTG GGCGGCCGCT TTTTTTTTTT TTTTTTT-3' end of cDNA).
cDNA sequence	DNA sequence (7921 bp) Predicted protein sequence (1023 aa)
Source
Rouge ID	mKIAA2030 by Kazusa Mouse cDNA Project

Length: 7921 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	4849 bp
Genome contig ID	gi89161213f_138496605
PolyA signal sequence (None)	+--------+--------+----*----+---- ACTCCAGCCTGGGCGACAGAGCAAGACTCCGTCTC
Flanking genome sequence (141367 - 141416)	----+--------+--------+--------+--------+----* AAAAAAAGAAAATAAAAGTATAGAAAAGTATCTTTTCACAAGAGGCCACC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	7	f	138596605	138637970	13	99.4	Perfect prediction

Length: 1023 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAC86361	100.0	unnamed protein...	Homo sapiens
EAL24038	100.0	hypothetical pr...	Homo sapiens
XP_001150254	99.7	hypothetical pr...	Pan troglodytes
XP_001150331	99.7	hypothetical pr...	Pan troglodytes
XP_001108123	98.4	similar to Ubin...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
ScanRegExp	IPR000217	865	871	PS00227	Tubulin

Primer_f
Primer_r
PCR conditions	test

Panel name	genbank
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-