KIAA2006

Product ID	ORK04300
Accession No	AB095927
Description	family with sequence similarity 208, member B
Clone name	ff02026
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4810 bp) Predicted protein sequence (1367 aa)
Source	Human fetal brain
Rouge ID	mKIAA2006 by Kazusa Mouse cDNA Project

Length: 4810 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	704 bp
Genome contig ID	gi89161187f_5712741
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- TGTGTTTCATTTTTTAAATAAAGACAACTAAAAAT
Flanking genome sequence (132968 - 133017)	----+--------+--------+--------+--------+----* AATCTCTTTCTGCAATGATTTTTATAGCAGAAATTGACTTATCTGGAGTG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	10	f	5812741	5845707	8	99.1	Perfect prediction

Length: 1367 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAC87251	96.5	unnamed protein...	Homo sapiens
EAW86433	96.5	hCG2042943 [Hom...	Homo sapiens
Q5VWN6	96.4	Uncharacterized...	Homo sapiens
CAH72617	99.8	chromosome 10 o...	Homo sapiens
XP_507637	94.7	similar to chro...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB029028	5.3e-26	28.8	KIAA1105

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Primer_f	TAAAACAATGGTCATGGAGGC
Primer_r	AGAGGCTGATGATGAGTCCAC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	genbank
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-