KIAA2023

Product ID	ORK06826
Accession No	AB095943
Description	SNF2 histone linker PHD RING helicase, E3 ubiquitin protein ligase
Clone name	ff05025
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (11657 bp) Predicted protein sequence (1092 aa)
Source	Human fetal brain
Rouge ID	mKIAA2023 by Kazusa Mouse cDNA Project

Length: 11657 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	Warning

Integrity of 3' end

Length of 3'UTR	7180 bp
Genome contig ID	gi89161210r_146166085
PolyA signal sequence (AATAAA,-16)	+--------+--------+----*----+---- ACTTTTAAAATATAATTAAAATAAACATCTGAGTG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAAAAACTGATTATGAAATTCTGAGTTTAAAATAGGAATAAAATAATTT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	6	r	146266085	146318085	24	99.4	Perfect prediction

Length: 1092 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAW47838	98.1	SNF2 histone li...	Homo sapiens
Q149N8	98.1	E3 ubiquitin-pr...	Homo sapiens
AAI17687	98.0	SHPRH protein [...	Homo sapiens
AAO26201	97.8	SNF2 histone li...	Homo sapiens
XP_001172960	99.6	SNF2 histone li...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR005818	23	97	PF00538	Histone H1/H5
	IPR001965	245	294	PF00628	Zinc finger
	IPR000330	303	450	PF00176	SNF2-related
HMMSmart	IPR005818	21	87	SM00526	Histone H1/H5
	IPR014001	112	460	SM00487	DEAD-like helicases
	IPR001965	245	292	SM00249	Zinc finger
	IPR001841	1017	1063	SM00184	Zinc finger
ProfileScan	IPR001841	1017	1064	PS50089	Zinc finger
ScanRegExp	IPR001965	246	291	PS01359	Zinc finger
ScanRegExp	IPR001841	1033	1042	PS00518	Zinc finger

Primer_f	ACATCAGCAAGAAACGCAGTC
Primer_r	AGGACTGCTTCTGAAACACTC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	genbank
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-