Order Kazusa clone(s) from : ![]() |
Product ID | ORK06826 |
---|---|
Accession No | AB095943 |
Description | SNF2 histone linker PHD RING helicase, E3 ubiquitin protein ligase |
Clone name | ff05025 |
Vector information | |
cDNA sequence | DNA sequence (11657 bp) Predicted protein sequence (1092 aa) |
Source | Human fetal brain |
Rouge ID |
mKIAA2023
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | Warning |
Length of 3'UTR | 7180 bp |
---|---|
Genome contig ID | gi89161210r_146166085 |
PolyA signal sequence (AATAAA,-16) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 6 | r | 146266085 | 146318085 | 24 | 99.4 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR005818 | 23 | 97 | PF00538 | Histone H1/H5 |
IPR001965 | 245 | 294 | PF00628 | Zinc finger | |
IPR000330 | 303 | 450 | PF00176 | SNF2-related | |
HMMSmart | IPR005818 | 21 | 87 | SM00526 | Histone H1/H5 |
IPR014001 | 112 | 460 | SM00487 | DEAD-like helicases | |
IPR001965 | 245 | 292 | SM00249 | Zinc finger | |
IPR001841 | 1017 | 1063 | SM00184 | Zinc finger | |
ProfileScan | IPR001841 | 1017 | 1064 | PS50089 | Zinc finger |
ScanRegExp | IPR001965 | 246 | 291 | PS01359 | Zinc finger |
IPR001841 | 1033 | 1042 | PS00518 | Zinc finger |
![]() |
Primer_f | ACATCAGCAAGAAACGCAGTC |
---|---|
Primer_r | AGGACTGCTTCTGAAACACTC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | genbank |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |