Order Kazusa clone(s) from : ![]() |
Product ID | ORK00715 |
---|---|
Accession No | AB028947 |
Description | KIAA1024 |
Clone name | fg00935s1 |
Vector information | |
cDNA sequence | DNA sequence (6741 bp) Predicted protein sequence (917 aa) |
HaloTag ORF Clone |
FHC00715
![]() |
Flexi ORF Clone | FXC00715 |
Source | Human fetal brain |
Rouge ID |
mKIAA1024
by Kazusa Mouse cDNA Project
|
Note | We replaced fg00935, former representative clones for KIAA1024 with fg00935s1. (2002/5/10) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 3915 bp |
---|---|
Genome contig ID | gi51511731f_77435493 |
PolyA signal sequence (AATAAA,-19) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (116206 - 116255) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 15 | f | 77511913 | 77551697 | 4 | 99.0 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR009626 | 759 | 917 | PF06789 | Protein of unknown function UPF0258 |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 891 | CKIAALIAAAACTVILVIVVPIC | 913 | PRIMARY | 23 |
---|
![]() |
Primer_f | CTGACGCTGAGGTTATGAATC |
---|---|
Primer_r | ACTCTATCTTGCTCATTCTGC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | UniGene |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |