KIAA1024

Product ID	ORK00715
Accession No	AB028947
Description	KIAA1024
Clone name	fg00935s1
Vector information	The cDNA fragment was originally inserted at SalI-NotI site ... The cDNA fragment was originally inserted at SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR) and a cDNA fragment (1-1101) was subcloned upstream of the cDNA (1102-6741). The adjacent sequence to the 5' end of the cDNA is as follows: CGACTCACTA TAGGGCGAAT TGGGTACCGG-5' end of cDNA.
cDNA sequence	DNA sequence (6741 bp) Predicted protein sequence (917 aa)
HaloTag ORF Clone	FHC00715
Flexi ORF Clone	FXC00715
Source	Human fetal brain
Rouge ID	mKIAA1024 by Kazusa Mouse cDNA Project
Note	We replaced fg00935, former representative clones for KIAA1024 with fg00935s1. (2002/5/10)

Length: 6741 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	3915 bp
Genome contig ID	gi51511731f_77435493
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- TCCAAATATAATCAGAAATAAACCGAAAAAAATAT
Flanking genome sequence (116206 - 116255)	----+--------+--------+--------+--------+----* AAAATGTCTTGCAGTGAGAGTTGATTTTATGCATAAATTATAAGTGTTCA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	15	f	77511913	77551697	4	99.0	Perfect prediction

Length: 917 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_001109121	97.4	hypothetical pr...	Macaca mulatta
EDL20892	89.2	cDNA sequence A...	Mus musculus
XP_001363522	83.4	similar to DD1 ...	Monodelphis dom...
AAU93887	81.3	DD1 protein [Ga...	Gallus gallus
XP_001507379	73.1	similar to DD1 ...	Ornithorhynchus...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR009626	759	917	PF06789	Protein of unknown function UPF0258

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	891	CKIAALIAAAACTVILVIVVPIC	913	PRIMARY	23

Primer_f	CTGACGCTGAGGTTATGAATC
Primer_r	ACTCTATCTTGCTCATTCTGC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	UniGene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-