|
Order Kazusa clone(s) from : |
| Product ID | ORK00715 |
|---|---|
| Accession No | AB028947 |
| Description | KIAA1024 |
| Clone name | fg00935s1 |
| Vector information | |
| cDNA sequence | DNA sequence (6741 bp) Predicted protein sequence (917 aa) |
|
HaloTag ORF Clone |
FHC00715
|
| Flexi ORF Clone | FXC00715 |
| Source | Human fetal brain |
| Rouge ID |
mKIAA1024
by Kazusa Mouse cDNA Project
|
| Note | We replaced fg00935, former representative clones for KIAA1024 with fg00935s1. (2002/5/10) |
Length: 6741 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).
| N-terminal truncation | Coding interruption | |
|---|---|---|
| cloned DNA seq | No warning | No warning |
Integrity of 3' end
| Length of 3'UTR | 3915 bp |
|---|---|
| Genome contig ID | gi51511731f_77435493 |
| PolyA signal sequence (AATAAA,-19) |
+----*----+----*----+----*----+---- |
| Flanking genome sequence (116206 - 116255) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
| Chr | f/r | start | end | exon | identity | class | |
|---|---|---|---|---|---|---|---|
|
| 15 | f | 77511913 | 77551697 | 4 | 99.0 | Perfect prediction |
Length: 917 aa
Result of homology search against nr database
(FASTA output,
Multiple alignment)![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database
(FASTA output,
Multiple alignment)
Result of motif / domain search (InterProScan and SOSUI)
Result of InterProScan
| Search method | interpro_ID | From | To | Entry | Definition |
|---|---|---|---|---|---|
| HMMPfam | IPR009626 | 759 | 917 | PF06789 | Protein of unknown function UPF0258 |
Prediction of transmembrane (TM) segments| Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 891 | CKIAALIAAAACTVILVIVVPIC | 913 | PRIMARY | 23 |
|---|
RT-PCR-ELISA
|
Experimental conditions| Primer_f | CTGACGCTGAGGTTATGAATC |
|---|---|
| Primer_r | ACTCTATCTTGCTCATTCTGC |
| PCR conditions | 95 °C 30 sec 55 °C 30 sec 72 °C 60 sec 30 cycles![]() |
Chromosome No. 15
Experimental conditions| Panel name | UniGene |
|---|---|
| Primer_f | - |
| Primer_r | - |
| PCR product length | - |
| PCR conditions | - |