Order Kazusa clone(s) from :
Japan
||
Other countries |
Product ID | ORK06679 |
---|---|
Accession No | AB037824 |
Description | RNA polymerase II associated protein 1 |
Clone name | fg02666s1 |
Vector information | |
cDNA sequence | DNA sequence (5897 bp) Predicted protein sequence (1337 aa) |
Source | Human fetal brain |
Rouge ID |
mKIAA1403
by Kazusa Mouse cDNA Project
|
Note | We replaced fg02666, former representative clones for KIAA1403 with fg02666s1. (2002/5/10) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 1846 bp |
---|---|
Genome contig ID | gi51511731r_39496669 |
PolyA signal sequence (AATAAA,-23) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 15 | r | 39596669 | 39623735 | 24 | 99.4 | Perfect prediction |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.Result of homology search against HUGE database (FASTA output, Multiple alignment)
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR013930 | 246 | 294 | PF08621 | RNA polymerase II-associated protein 1 |
IPR013929 | 376 | 447 | PF08620 | RNA polymerase II-associated protein 1 |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 698 | RLWAVAASYGQGGYLYRELYPVL | 720 | SECONDARY | 23 | 2 | 743 | RIASLLTLLTQLTLAAGSTPAET | 765 | SECONDARY | 23 | 3 | 772 | ASLSATPSLVTWTQVSGLQPLVE | 794 | SECONDARY | 23 | 4 | 805 | SRPEMWRAVGPVPVACLLFLGA | 826 | PRIMARY | 22 | 5 | 916 | LTALLSLLNTLAQIHKGLCGQLA | 938 | SECONDARY | 23 |
---|
RT-PCR-ELISA |
Primer_f | GATGGAAAGATGGGTACGTTG |
---|---|
Primer_r | ATGTAATGGTAGGGCTCACTG |
PCR conditions | 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles |
Panel name | unigene |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |