KIAA1406

Product ID	ORK04099
Accession No	AB037827
Description	anaphase promoting complex subunit 2
Clone name	fg03519s1
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pYO326 vector. The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector. pYO326 shuttle vector, pYO326 (Amp-r) was kindly provided by Y. Ohya (University of Tokyo).
cDNA sequence	DNA sequence (1876 bp) Predicted protein sequence (571 aa)
Source	Human fetal brain
Rouge ID	mKIAA1406 by Kazusa Mouse cDNA Project
Note	We replaced fg03519, former representative clones for KIAA1406 with fg03519s1. (2002/5/10)

Length: 1876 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	158 bp
Genome contig ID	gi89161216r_139089057
PolyA signal sequence (ATTAAA,-21)	+--------+--------+----*----+---- CCCGCAGTGTGCAGATTAAAGCAAGTCAGATCATC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* CTTTTCTGTCCTGGTGGCTTTGTGGGGCCCCCCAGGATCCTCCTCTAGCC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	9	r	139189057	139200618	11	99.8	Perfect prediction

Length: 571 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9UJX6	100.0	Anaphase-promot...	Homo sapiens
XP_001089959	99.5	anaphase-promot...	Macaca mulatta
AAH01579	99.5	ANAPC2 protein ...	Homo sapiens
XP_548357	97.2	similar to Anap...	Canis lupus fam...
EDL93618	96.8	anaphase promot...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB014595	1.1e-08	28.0	KIAA0695

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001373	70	484	PF00888	Cullin
HMMPfam	IPR014786	506	566	PF08672	Anaphase promoting complex subunit 2
HMMSmart	IPR001373	249	397	SM00182	Cullin
ProfileScan	IPR001373	251	449	PS50069	Cullin

Primer_f	CTGCTGCTCTTCTGGACGTAC
Primer_r	GTCACCACAAACATGCGGAGC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	CTGCTGCTCTTCTGGACGTAC
Primer_r	GTCACCACAAACATGCGGAGC
PCR product length	98 bp
PCR conditions	95 °C15 sec66 °C60 sec30 cycles