KIAA1855

Product ID	ORK07236
Accession No	AB058758
Description	tau tubulin kinase 1
Clone name	fg04654
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (6697 bp) Predicted protein sequence (1270 aa)
Source	Human fetal brain
Rouge ID	mKIAA1855 by Kazusa Mouse cDNA Project

Length: 6697 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	Warning

Integrity of 3' end

Length of 3'UTR	2883 bp
Genome contig ID	gi89161210f_43228499
PolyA signal sequence (ATTAAA,-23)	+--------+--------+----*----+---- AGCCATCACACCATTAAAAAGCCTGTGGACCTTTT
Flanking genome sequence (135478 - 135527)	----+--------+--------+--------+--------+----* TCTGTTGGCTTGGACTCTTCTTCCCTGAGGGAGGGCAGGCAAAACCCAGT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	6	f	43328499	43363975	13	100.0	Perfect prediction

Length: 1270 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q5TCY1	100.0	Tau-tubulin kin...	Homo sapiens
BAE78660	100.0	brain-derived t...	Homo sapiens
EAX04169	100.0	tau tubulin kin...	Homo sapiens
XP_001088342	97.4	similar to tau ...	Macaca mulatta
Q6PCN3	89.2	Tau-tubulin kin...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR000719	5	204	PD000001	Protein kinase
HMMPfam	IPR000719	1	109	PF00069	Protein kinase
HMMPfam	IPR000719	125	189	PF00069	Protein kinase
HMMSmart	IPR002290	1	257	SM00220	Serine/threonine protein kinase
HMMSmart	IPR001245	3	242	SM00219	Tyrosine protein kinase
ProfileScan	IPR000719	1	246	PS50011	Protein kinase

Primer_f	TCAAGGACAAGGAACAGGTAG
Primer_r	CTCTCCTTCATGCTGTTCTCA
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	CCATTTCCCAGCTCCTCACAG
Primer_r	AACATTCTTAGGTGGCTTCCC
PCR product length	95 bp
PCR conditions	15 °C64 sec60 °C30 sec130 cycles