Gene/Protein Characteristic Table for KIAA1667
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK05452
Accession No AB051454
Description Hermansky-Pudlak syndrome 4
Clone name fg05049
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (6118 bp)
Predicted protein sequence (505 aa)
Source Human fetal brain
Rouge ID mKIAA1667 by Kazusa Mouse cDNA Project
Features of the cloned cDNA sequence
Description

Length: 6118 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq No warning Warning
Integrity of 3' end
Length of 3'UTR 1133 bp
Genome contig ID gi89161203r_25078066
PolyA signal sequence
(AATAAA,-24)
+----*----+----*----+----*----+----
CAAGGGCTAGAAATAAAATAGCCAAAAAATGCTGG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AGTTCTGAGTAATTAAATGGCAGCATTTTTTTGTGACAAAGGTAAGGGTT

Ensembl ContigView (Add our DAS server as a DAS source)


Chr f/r start end exon identity class
Ensembl gnome browser 22 r 25178066 25209803 13 99.3 Perfect prediction
Features of the protein sequence
Description

Length: 505 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
EAW59717 5e-177 98.1 Hermansky-Pudla...
Homo sapiens
EAW59718 5e-177 98.1 Hermansky-Pudla...
Homo sapiens
AAH65030 7.5e-177 97.9 Hermansky-Pudla...
Homo sapiens
CAD28549 8.6e-177 97.9 hypothetical pr...
Homo sapiens
CAB97208 5.7e-176 97.5 hypothetical pr...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
No significant homologues
Expression profile
Description

RT-PCR-ELISA
Experimental conditions
Primer_f
Primer_r
PCR conditions test

RH mapping information
Description

Chromosome No. 22
Experimental conditions
Panel name genbank
Primer_f -
Primer_r -
PCR product length -
PCR conditions -
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp