KIAA1653

Product ID	ORK05688
Accession No	AB051440
Description	Homo sapiens mRNA for KIAA1653 protein, partial cds.
Clone name	fg06691
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5868 bp) Predicted protein sequence (193 aa)
Source	Human fetal brain

Length: 5868 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	Warning

Integrity of 3' end

Length of 3'UTR	2801 bp
Genome contig ID	gi89161203f_18571561
PolyA signal sequence (GATAAA,-21)	+--------+--------+----*----+---- TAGCTACGTTAAAAGATAAAATGAATTTCAAGAAT
Flanking genome sequence (108157 - 108206)	----+--------+--------+--------+--------+----* ACATTTTAATTAACCCAAAATATACAAAATATTACTTCAAATTGTATTCA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	22	f	18671561	18679716	3	99.5	Perfect prediction
Ensembl gnome browser	22	r	17281738	17355165	8	95.6	Both No-hit

Length: 193 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q9BYA7	2.2e-83	100.0	Putative prolin...	Homo sapiens
XP_525525	1.7e-56	95.1	similar to PROD...	Pan troglodytes
BAD92709	1.2e-54	93.7	Proline oxidase...	Homo sapiens
AAI18598	1.9e-54	93.7	PRODH protein [...	Homo sapiens
AAI21810	1.9e-54	93.7	PRODH protein [...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR002872	1	193	PF01619	Proline dehydrogenase

Primer_f
Primer_r
PCR conditions	test

Panel name	genbank
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-