KIAA1538

Product ID	ORK00858
Accession No	AB040971
Description	zinc finger and BTB domain containing 4, transcript variant 1
Clone name	fg06773
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5851 bp) Predicted protein sequence (1029 aa)
HaloTag ORF Clone	FHC00858
Flexi ORF Clone	FXC00858
Source	Human fetal brain
Rouge ID	mKIAA1538 by Kazusa Mouse cDNA Project
Note	We replaced hk07166, former representative clones for KIAA1538 with fg06773. (2002/5/10)

Length: 5851 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	2559 bp
Genome contig ID	gi51511734r_7203423
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- CAACTCTGTAGGCCAATAAACCAACAAGACAAATG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AACTGTGCTCCACAGTGGGATGCCAGGTGCAATTATTTGCGTGGCTGGTG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	17	r	7303423	7323668	4	99.2	Perfect prediction

Length: 1029 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
XP_511299	0	99.3	zinc finger and...	Pan troglodytes
Q9P1Z0	0	100.0	Zinc finger and...	Homo sapiens
AAH43352	0	99.8	Zinc finger and...	Homo sapiens
XP_546592	0	89.9	similar to Zinc...	Canis lupus fam...
BAG53746	2.4e-202	100.0	unnamed protein...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR013069	36	194	PF00651	BTB/POZ
	IPR007087	250	272	PF00096	Zinc finger
	IPR007087	325	347	PF00096	Zinc finger
	IPR007087	381	404	PF00096	Zinc finger
	IPR007087	742	764	PF00096	Zinc finger
	IPR007087	781	803	PF00096	Zinc finger
HMMSmart	IPR000210	46	203	SM00225	BTB/POZ-like
	IPR015880	250	270	SM00355	Zinc finger
	IPR015880	325	347	SM00355	Zinc finger
	IPR015880	353	375	SM00355	Zinc finger
	IPR015880	381	404	SM00355	Zinc finger
	IPR015880	742	764	SM00355	Zinc finger
	IPR015880	781	803	SM00355	Zinc finger
ProfileScan	IPR000210	46	168	PS50097	BTB/POZ-like
	IPR007087	250	278	PS50157	Zinc finger
	IPR007087	325	352	PS50157	Zinc finger
	IPR007087	353	380	PS50157	Zinc finger
	IPR007087	381	404	PS50157	Zinc finger
	IPR007087	742	769	PS50157	Zinc finger
	IPR007087	781	808	PS50157	Zinc finger
ScanRegExp	IPR007087	327	347	PS00028	Zinc finger
	IPR007087	355	375	PS00028	Zinc finger
	IPR007087	383	404	PS00028	Zinc finger
	IPR007087	744	764	PS00028	Zinc finger
	IPR007087	783	803	PS00028	Zinc finger

Primer_f	GCCGCAGCACGCAAAATTTAG
Primer_r	TTGGCCTACAGAGTTGGACAC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	GCCGCAGCACGCAAAATTTAG
Primer_r	TTGGCCTACAGAGTTGGACAC
PCR product length	122 bp
PCR conditions	95 °C15 sec64 °C60 sec32 cycles