Order Kazusa clone(s) from : ![]() |
Product ID | ORK00502 |
---|---|
Accession No | AB002314 |
Description | FERM and PDZ domain containing 4 |
Clone name | fg06820 |
Vector information | |
cDNA sequence | DNA sequence (6352 bp) Predicted protein sequence (1379 aa) |
Flexi ORF Clone | FXC00502 |
Source | Human fetal brain |
Rouge ID |
mKIAA0316
by Kazusa Mouse cDNA Project
|
Note | We replaced hg00253, former representative clones for KIAA0316 with fg06820. (2002/12/27) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | Warning |
Length of 3'UTR | 1877 bp |
---|---|
Genome contig ID | gi89161218f_11966506 |
PolyA signal sequence (AATAAA,-22) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (683946 - 683995) |
----+----*----+----*----+----*----+----*----+----* |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR001478 | 144 | 209 | PF00595 | PDZ/DHR/GLGF |
HMMSmart | IPR001478 | 142 | 212 | SM00228 | PDZ/DHR/GLGF |
IPR000299 | 259 | 481 | SM00295 | Band 4.1 | |
ProfileScan | IPR001202 | 90 | 123 | PS50020 | WW/Rsp5/WWP |
IPR001478 | 135 | 212 | PS50106 | PDZ/DHR/GLGF | |
IPR000299 | 261 | 576 | PS50057 | Band 4.1 |
![]() |
---|
Primer_f | GATTTTGTCCCAGTACTACGC |
---|---|
Primer_r | CAGTAATGTAGACCAGACCAC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | GATTTTGTCCCAGTACTACGC |
Primer_r | CAGTAATGTAGACCAGACCAC |
PCR product length | 148 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |