KIAA1303

Product ID	ORK06594
Accession No	AB037724
Description	regulatory associated protein of MTOR, complex 1
Clone name	fg07086
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5538 bp) Predicted protein sequence (1119 aa)
Source	Human fetal brain
Rouge ID	mKIAA1303 by Kazusa Mouse cDNA Project

Length: 5538 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	Warning

Integrity of 3' end

Length of 3'UTR	2043 bp
Genome contig ID	gi51511734f_76231682
PolyA signal sequence (AGTAAA,-22)	+--------+--------+----*----+---- GAGAGTGACCAACAGTAAACAACACGCGCAGACTC
Flanking genome sequence (323086 - 323135)	----+--------+--------+--------+--------+----* CGCGGCTGGCGGCTGTGTCTTTAAGGAAACTGCCCACCCCACCTCAGGGG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	17	f	76331682	76554766	30	99.5	Perfect prediction

Length: 1119 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q8N122	99.9	Regulatory-asso...	Homo sapiens
XP_511729	99.2	raptor isoform ...	Pan troglodytes
XP_001161716	99.2	raptor isoform ...	Pan troglodytes
EAW89619	100.0	raptor, isoform...	Homo sapiens
XP_001110429	98.5	similar to rapt...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR004083	42	62	PR01547	Regulatory associated protein of TOR
	IPR004083	82	109	PR01547	Regulatory associated protein of TOR
	IPR004083	117	141	PR01547	Regulatory associated protein of TOR
	IPR004083	192	222	PR01547	Regulatory associated protein of TOR
	IPR004083	223	244	PR01547	Regulatory associated protein of TOR
	IPR004083	246	265	PR01547	Regulatory associated protein of TOR
	IPR004083	270	286	PR01547	Regulatory associated protein of TOR
	IPR004083	962	980	PR01547	Regulatory associated protein of TOR
HMMPfam	IPR000357	335	372	PF02985	HEAT
	IPR000357	382	414	PF02985	HEAT
	IPR000357	589	625	PF02985	HEAT
	IPR001680	863	881	PF00400	WD40 repeat
	IPR001680	940	978	PF00400	WD40 repeat
	IPR001680	985	1024	PF00400	WD40 repeat
	IPR001680	1086	1113	PF00400	WD40 repeat
HMMSmart	IPR001680	796	834	SM00320	WD40 repeat
	IPR001680	836	881	SM00320	WD40 repeat
	IPR001680	889	935	SM00320	WD40 repeat
	IPR001680	938	978	SM00320	WD40 repeat
	IPR001680	984	1024	SM00320	WD40 repeat
	IPR001680	1030	1065	SM00320	WD40 repeat
	IPR001680	1067	1113	SM00320	WD40 repeat
ProfileScan	IPR001680	903	1033	PS50294	WD40 repeat

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	236	LLGRFLDLGPWAVSLALSVGIFP	258	PRIMARY	23
SOSUI2	2	317	TMTAFILAVIVNSYHTGQEACLQ	339	SECONDARY	23

Primer_f	GCCTGAAGGAGATGTCTAACC
Primer_r	GCAGTTTTTCATCGACGGAGG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-