Order Kazusa clone(s) from : ![]() |
Product ID | ORK06594 |
---|---|
Accession No | AB037724 |
Description | regulatory associated protein of MTOR, complex 1 |
Clone name | fg07086 |
Vector information | |
cDNA sequence | DNA sequence (5538 bp) Predicted protein sequence (1119 aa) |
Source | Human fetal brain |
Rouge ID |
mKIAA1303
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | Warning |
Length of 3'UTR | 2043 bp |
---|---|
Genome contig ID | gi51511734f_76231682 |
PolyA signal sequence (AGTAAA,-22) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (323086 - 323135) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 17 | f | 76331682 | 76554766 | 30 | 99.5 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
FPrintScan | IPR004083 | 42 | 62 | PR01547 | Regulatory associated protein of TOR |
IPR004083 | 82 | 109 | PR01547 | Regulatory associated protein of TOR | |
IPR004083 | 117 | 141 | PR01547 | Regulatory associated protein of TOR | |
IPR004083 | 192 | 222 | PR01547 | Regulatory associated protein of TOR | |
IPR004083 | 223 | 244 | PR01547 | Regulatory associated protein of TOR | |
IPR004083 | 246 | 265 | PR01547 | Regulatory associated protein of TOR | |
IPR004083 | 270 | 286 | PR01547 | Regulatory associated protein of TOR | |
IPR004083 | 962 | 980 | PR01547 | Regulatory associated protein of TOR | |
HMMPfam | IPR000357 | 335 | 372 | PF02985 | HEAT |
IPR000357 | 382 | 414 | PF02985 | HEAT | |
IPR000357 | 589 | 625 | PF02985 | HEAT | |
IPR001680 | 863 | 881 | PF00400 | WD40 repeat | |
IPR001680 | 940 | 978 | PF00400 | WD40 repeat | |
IPR001680 | 985 | 1024 | PF00400 | WD40 repeat | |
IPR001680 | 1086 | 1113 | PF00400 | WD40 repeat | |
HMMSmart | IPR001680 | 796 | 834 | SM00320 | WD40 repeat |
IPR001680 | 836 | 881 | SM00320 | WD40 repeat | |
IPR001680 | 889 | 935 | SM00320 | WD40 repeat | |
IPR001680 | 938 | 978 | SM00320 | WD40 repeat | |
IPR001680 | 984 | 1024 | SM00320 | WD40 repeat | |
IPR001680 | 1030 | 1065 | SM00320 | WD40 repeat | |
IPR001680 | 1067 | 1113 | SM00320 | WD40 repeat | |
ProfileScan | IPR001680 | 903 | 1033 | PS50294 | WD40 repeat |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 236 | LLGRFLDLGPWAVSLALSVGIFP | 258 | PRIMARY | 23 | 2 | 317 | TMTAFILAVIVNSYHTGQEACLQ | 339 | SECONDARY | 23 |
---|
![]() |
Primer_f | GCCTGAAGGAGATGTCTAACC |
---|---|
Primer_r | GCAGTTTTTCATCGACGGAGG |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | unigene |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |