Order Kazusa clone(s) from : ![]() |
Product ID | ORK00719 |
---|---|
Accession No | AB028959 |
Description | vasohibin 1 |
Clone name | fh01447 |
Vector information | |
cDNA sequence | DNA sequence (5481 bp) Predicted protein sequence (380 aa) |
HaloTag ORF Clone |
FHC00719
![]() |
Flexi ORF Clone | FXC00719 |
Source | Human fetal brain |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 3998 bp |
---|---|
Genome contig ID | gi51511730f_76198533 |
PolyA signal sequence (None) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (120581 - 120630) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 14 | f | 76298533 | 76319112 | 7 | 99.2 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
Primer_f | TATTGACCGTCTCGCTCCATC |
---|---|
Primer_r | GGGCAATACTGAGATGAGAAC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | UniGene |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |