KIAA1036

Gene/Protein Characteristic Table for KIAA1036

Order Kazusa clone(s) from :

Product ID	ORK00719
Accession No	AB028959
Description	vasohibin 1
Clone name	fh01447
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5481 bp) Predicted protein sequence (380 aa)
HaloTag ORF Clone	FHC00719
Flexi ORF Clone	FXC00719
Source	Human fetal brain

Features of the cloned cDNA sequence

Description

Length: 5481 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	3998 bp
Genome contig ID	gi51511730f_76198533
PolyA signal sequence (None)	+--------+--------+----*----+---- AGCTCCTGCTGTGTAGGCTGGGCAGAAACCACAAC
Flanking genome sequence (120581 - 120630)	----+--------+--------+--------+--------+----* ACGTAAGCCTTGTCTCCTTTCCTTTGGAGCTGGGGCCCGAGCCCTCCCCC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	14	f	76298533	76319112	7	99.2	Perfect prediction

Features of the protein sequence

Description

Length: 380 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAF84066	2.5e-139	99.7	unnamed protein...	Homo sapiens
XP_522911	6.7e-139	99.2	vasohibin 1 [Pa...	Pan troglodytes
XP_001100694	4.6e-138	98.4	vasohibin 1 [Ma...	Macaca mulatta
XP_854168	1.7e-133	95.1	similar to Vaso...	Canis lupus fam...
XP_001493030	4.6e-133	94.8	similar to vaso...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Expression profile

Description

RT-PCR-ELISA

Experimental conditions

Primer_f	TATTGACCGTCTCGCTCCATC
Primer_r	GGGCAATACTGAGATGAGAAC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information

Description

Chromosome No. 14

Experimental conditions

Panel name	UniGene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-

Order Kazusa clone(s) from :

Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp