KIAA1038

Product ID	ORK05398
Accession No	AB028961
Description	HBS1-like translational GTPase
Clone name	fh02273
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5662 bp) Predicted protein sequence (496 aa)
Source	Human fetal brain
Rouge ID	mKIAA1038 by Kazusa Mouse cDNA Project

Length: 5662 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	4171 bp
Genome contig ID	gi89161210r_135223941
PolyA signal sequence (None)	+--------+--------+----*----+---- ATGAATGGAATTAGTGAAACTATTCATATCAATGC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAAAAAAGCAAAGAAACTAAGTCTGTACAGCAAAAGAT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	6	r	135323941	135360462	13	99.3	Perfect prediction

Length: 496 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAH12760	6.9e-203	100.0	unnamed protein...	Homo sapiens
BAH12101	8.2e-203	100.0	unnamed protein...	Homo sapiens
BAF85345	8.6e-203	100.0	unnamed protein...	Homo sapiens
Q9Y450	8.6e-203	100.0	HBS1-like prote...	Homo sapiens
BAG51281	2.9e-202	99.8	unnamed protein...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR000795	74	87	PR00315	Protein synthesis factor
	IPR000795	133	141	PR00315	Protein synthesis factor
	IPR000795	153	163	PR00315	Protein synthesis factor
	IPR000795	169	180	PR00315	Protein synthesis factor
	IPR000795	213	222	PR00315	Protein synthesis factor
HMMPfam	IPR000795	70	293	PF00009	Protein synthesis factor
	IPR004161	314	381	PF03144	Translation elongation factor EFTu/EF1A
	IPR004160	387	495	PF03143	Translation elongation factor EFTu/EF1A

Primer_f	ATCCACTGTGTAAGAAGACTG
Primer_r	GGTAGGAAATCAGAGCATAAC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	UniGene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-