Order Kazusa clone(s) from :
Japan
||
Other countries |
Product ID | ORK00080 |
---|---|
Accession No | AB007924 |
Description | lipid phosphate phosphatase-related protein type 4, transcript variant 1 |
Clone name | fh02485 |
Vector information | |
cDNA sequence | DNA sequence (5014 bp) Predicted protein sequence (814 aa) |
HaloTag ORF Clone |
FHC00080
|
Flexi ORF Clone | FXC00080 |
Source | Human fetal brain |
Rouge ID |
mKIAA0455
by Kazusa Mouse cDNA Project
|
Note | We replaced hg00513, former representative clones for KIAA0455 with fh02485. (2005/08/06) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 2568 bp |
---|---|
Genome contig ID | gi89161185f_99402440 |
PolyA signal sequence (AATAAA,-23) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (145286 - 145335) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 1 | f | 99502440 | 99547724 | 7 | 99.2 | Perfect prediction |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.Result of homology search against HUGE database (FASTA output, Multiple alignment)
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR000326 | 229 | 382 | PF01569 | Phosphoesterase |
HMMSmart | IPR000326 | 230 | 374 | SM00014 | Phosphoesterase |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 116 | TLLPCFYFVELPILASSVVSLYF | 138 | PRIMARY | 23 | 2 | 173 | FLMLLSLAFAGPAITIMVGEGIL | 195 | PRIMARY | 23 |
---|
Primer_f | |
---|---|
Primer_r | |
PCR conditions | °C sec °C sec cycles |
Panel name | GeneBridge 4 |
---|---|
Primer_f | ATCAGTAAAGCACAGCCTAAC |
Primer_r | AGGTGGTATCTCTTCTTAGTG |
PCR product length | 83 bp |
PCR conditions | 95 °C15 sec62 °C60 sec30 cycles |