KIAA1447

Gene/Protein Characteristic Table for KIAA1447

Order Kazusa clone(s) from :

Product ID	ORK04251
Accession No	AB040880
Description	BAH domain and coiled-coil containing 1
Clone name	fh04686
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5166 bp) Predicted protein sequence (1721 aa)
Source	Human fetal brain

Length: 5166 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	0 bp
Genome contig ID	gi51511734f_76925445
PolyA signal sequence (None)	+--------+--------+----*----+---- CAAAGCCAAAGAGCTCTCCCGGAGGCAGCGGCCGC
Flanking genome sequence (118144 - 118193)	----+--------+--------+--------+--------+----* CCTCCGTGGAAAACCGGCCAAAGATCTCAGCCTTCCTGCCCGCCCGGCAG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	17	f	77025445	77043587	22	99.7	Perfect prediction

Features of the protein sequence

Description

Length: 1721 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAW89653	99.9	hCG1987554, iso...	Homo sapiens
Q9P281	98.0	BAH and coiled-...	Homo sapiens
BAE27797	75.7	unnamed protein...	Mus musculus
Q3UHR0	75.7	BAH and coiled-...	Mus musculus
NP_940815	75.6	BAH domain and ...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB058759	0.00064	27.0	KIAA1856

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Expression profile

Description

RT-PCR-ELISA

Experimental conditions

Primer_f	CCAAGAAGGTATCCAGTGAGG
Primer_r	TTAGGAGTTCGGCTTTACCAG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information

Description

Chromosome No. 17

Experimental conditions

Panel name	CCR
Primer_f	AGGAGAGGACGAGGCTATGTG
Primer_r	AACTCTACGCGGTCTTTGCTG
PCR product length	85(500) bp
PCR conditions	95 °C15 sec66 °C60 sec30 cycles

Order Kazusa clone(s) from :

Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp