Order Kazusa clone(s) from : ![]() |
Product ID | ORK00773 |
---|---|
Accession No | AB033053 |
Description | zinc finger and BTB domain containing 21, transcript variant 2 |
Clone name | fh04710 |
Vector information | |
cDNA sequence | DNA sequence (5561 bp) Predicted protein sequence (1069 aa) |
Flexi ORF Clone | FXC00773 |
Source | Human fetal brain |
Rouge ID |
mKIAA1227
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 2257 bp |
---|---|
Genome contig ID | gi51511750r_42181816 |
PolyA signal sequence (AATAAA,-22) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 21 | r | 42281816 | 42303519 | 2 | 99.0 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR013069 | 23 | 129 | PF00651 | BTB/POZ |
IPR007087 | 549 | 572 | PF00096 | Zinc finger | |
IPR007087 | 673 | 695 | PF00096 | Zinc finger | |
IPR007087 | 912 | 935 | PF00096 | Zinc finger | |
IPR007087 | 940 | 962 | PF00096 | Zinc finger | |
IPR007087 | 1046 | 1068 | PF00096 | Zinc finger | |
HMMSmart | IPR000210 | 33 | 129 | SM00225 | BTB/POZ-like |
IPR015880 | 549 | 572 | SM00355 | Zinc finger | |
IPR015880 | 578 | 601 | SM00355 | Zinc finger | |
IPR015880 | 673 | 695 | SM00355 | Zinc finger | |
IPR015880 | 725 | 745 | SM00355 | Zinc finger | |
IPR015880 | 751 | 771 | SM00355 | Zinc finger | |
IPR015880 | 778 | 801 | SM00355 | Zinc finger | |
IPR015880 | 912 | 932 | SM00355 | Zinc finger | |
IPR015880 | 940 | 962 | SM00355 | Zinc finger | |
IPR015880 | 1046 | 1068 | SM00355 | Zinc finger | |
ProfileScan | IPR000210 | 33 | 99 | PS50097 | BTB/POZ-like |
IPR007087 | 549 | 577 | PS50157 | Zinc finger | |
IPR007087 | 673 | 700 | PS50157 | Zinc finger | |
IPR007087 | 778 | 806 | PS50157 | Zinc finger | |
IPR007087 | 912 | 939 | PS50157 | Zinc finger | |
IPR007087 | 940 | 967 | PS50157 | Zinc finger | |
IPR007087 | 1046 | 1069 | PS50157 | Zinc finger | |
ScanRegExp | IPR007087 | 551 | 572 | PS00028 | Zinc finger |
IPR007087 | 580 | 601 | PS00028 | Zinc finger | |
IPR007087 | 675 | 695 | PS00028 | Zinc finger | |
IPR007087 | 780 | 801 | PS00028 | Zinc finger | |
IPR007087 | 942 | 962 | PS00028 | Zinc finger | |
IPR007087 | 1048 | 1068 | PS00028 | Zinc finger |
![]() |
Primer_f | TTACTTCCAGATAGAGCAGAG |
---|---|
Primer_r | AGCAATGATGTAGAGAATGGC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | TTACTTCCAGATAGAGCAGAG |
Primer_r | AGCAATGATGTAGAGAATGGC |
PCR product length | 175 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |