KIAA1452

Gene/Protein Characteristic Table for KIAA1452

Order Kazusa clone(s) from :

Product ID	ORK06428
Accession No	AB040885
Description	polymerase (RNA) III (DNA directed) polypeptide E (80kD)
Clone name	fh12994
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4800 bp) Predicted protein sequence (694 aa)
Source	Human fetal brain
Rouge ID	mKIAA1452 by Kazusa Mouse cDNA Project

Features of the cloned cDNA sequence

Description

Length: 4800 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	2714 bp
Genome contig ID	gi51511732f_22116277
PolyA signal sequence (None)	+--------+--------+----*----+---- GACTGGGCGACAGAGCAAGACTGTGTCTCAGAAAG
Flanking genome sequence (131638 - 131687)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAACATAGATTCAGTTCTGTTCAGTAGGTATGCGGTACT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	16	f	22216277	22247913	18	99.3	Perfect prediction

Features of the protein sequence

Description

Length: 694 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAW50606	100.0	polymerase (RNA...	Homo sapiens
XP_511201	96.5	hypothetical pr...	Pan troglodytes
AAH00285	100.0	POLR3E protein ...	Homo sapiens
Q9NVU0	100.0	DNA-directed RN...	Homo sapiens
AAM18215	99.8	RNA polymerase ...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR006886	44	474	PF04801	Sin-like protein conserved region

Expression profile

Description

RT-PCR-ELISA

Experimental conditions

Primer_f	TGCAGCCACACATTTCAGATT
Primer_r	ATGATTCTGATGGAGCTGGCT
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information

Description

Chromosome No. 16

Experimental conditions

Panel name	GeneBridge 4
Primer_f	CCTGGGCTGCTTTTCTGTCAC
Primer_r	CCCATTTTGCTGCCAGGTCTG
PCR product length	167 bp
PCR conditions	95 °C15 sec66 °C60 sec30 cycles

Order Kazusa clone(s) from :

Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp