Gene/Protein Characteristic Table for KIAA1452
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK06428
Accession No AB040885
Description polymerase (RNA) III (DNA directed) polypeptide E (80kD)
Clone name fh12994
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (4800 bp)
Predicted protein sequence (694 aa)
Source Human fetal brain
Rouge ID mKIAA1452 by Kazusa Mouse cDNA Project
Features of the cloned cDNA sequence
Description

Length: 4800 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq Warning No warning
Integrity of 3' end
Length of 3'UTR 2714 bp
Genome contig ID gi51511732f_22116277
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
GACTGGGCGACAGAGCAAGACTGTGTCTCAGAAAG
Flanking genome sequence
(131638 - 131687)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAACATAGATTCAGTTCTGTTCAGTAGGTATGCGGTACT

Ensembl ContigView (Add our DAS server as a DAS source)


Chr f/r start end exon identity class
Ensembl gnome browser 16 f 22216277 22247913 18 99.3 Perfect prediction
Features of the protein sequence
Description

Length: 694 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
EAW50606 0 100.0 polymerase (RNA...
Homo sapiens
XP_511201 0 96.5 hypothetical pr...
Pan troglodytes
AAH00285 0 100.0 POLR3E protein ...
Homo sapiens
Q9NVU0 0 100.0 DNA-directed RN...
Homo sapiens
AAM18215 0 99.8 RNA polymerase ...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR006886 44 474 PF04801 Sin-like protein conserved region
Expression profile
Description

RT-PCR-ELISA
Experimental conditions
Primer_f TGCAGCCACACATTTCAGATT
Primer_r ATGATTCTGATGGAGCTGGCT
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 16
Experimental conditions
Panel name GeneBridge 4
Primer_f CCTGGGCTGCTTTTCTGTCAC
Primer_r CCCATTTTGCTGCCAGGTCTG
PCR product length 167 bp
PCR conditions 95 °C15 sec66 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp