KIAA1519

Product ID	ORK00856
Accession No	AB040952
Description	centrosomal protein 72kDa
Clone name	fh13905s1
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pYO326 vector. The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector. pYO326 shuttle vector, pYO326 (Amp-r) was kindly provided by Y. Ohya (University of Tokyo).
cDNA sequence	DNA sequence (2352 bp) Predicted protein sequence (648 aa)
HaloTag ORF Clone	FHC00856
Flexi ORF Clone	FXC00856
Source	Human fetal brain
Rouge ID	mKIAA1519 by Kazusa Mouse cDNA Project
Note	We replaced fh13905, former representative clones for KIAA1519 with fh13905s1. (2002/5/10)

Length: 2352 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	398 bp
Genome contig ID	gi51511721f_565467
PolyA signal sequence (AATAAA,-23)	+--------+--------+----*----+---- CAATCTTTATTTAATAAACAAATAACATTGTTCTG
Flanking genome sequence (141199 - 141248)	----+--------+--------+--------+--------+----* AAAAGTTAACTTTTTCAGTGGCTGTATACAAATTATAACTGAGTTTGTCA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	5	f	665467	706664	12	99.7	Perfect prediction

Length: 648 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
EAW51012	0	100.0	centrosomal pro...	Homo sapiens
Q9P209	0	99.8	Centrosomal pro...	Homo sapiens
AAH01750	0	99.8	CEP72 protein [...	Homo sapiens
XP_517604	0	97.8	centrosomal pro...	Pan troglodytes
EAW51011	4.3e-211	100.0	centrosomal pro...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001611	57	70	PR00019	Leucine-rich repeat
FPrintScan	IPR001611	76	89	PR00019	Leucine-rich repeat
HMMPfam	IPR001611	56	76	PF00560	Leucine-rich repeat
HMMPfam	IPR001611	78	98	PF00560	Leucine-rich repeat
HMMSmart	IPR003591	54	75	SM00369	Leucine-rich repeat
	IPR003591	76	98	SM00369	Leucine-rich repeat
	IPR003603	118	136	SM00446	U2A'/phosphoprotein 32 family A

Primer_f	TACCAAGAGAAGATCACCCAC
Primer_r	AACACTTCTGCCAACGAGGAG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-