Gene/Protein Characteristic Table for KIAA1328
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK00804
Accession No AB037749
Description KIAA1328
Clone name fh14746s1
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (5520 bp)
Predicted protein sequence (585 aa)
Source Human fetal brain
Rouge ID mKIAA1328 by Kazusa Mouse cDNA Project
Note We replaced fh14746, former representative clones for KIAA1328 with fh14746s1. (2002/5/10)
Features of the cloned cDNA sequence
Description

Length: 5520 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq No warning No warning

Ensembl ContigView (Add our DAS server as a DAS source)


Chr f/r start end exon identity class
Ensembl gnome browser 18 f 32666995 33063846 11 99.2 Perfect prediction
Features of the protein sequence
Description

Length: 585 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAF84977 6.9e-196 99.8 unnamed protein...
Homo sapiens
XP_001139184 1.1e-191 98.4 hypothetical pr...
Pan troglodytes
XP_001106820 2.8e-182 94.1 hypothetical pr...
Macaca mulatta
BAB46887 1.6e-167 94.0 hypothetical pr...
Macaca fascicularis
BAG65099 1.2e-152 96.0 unnamed protein...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
No significant homologues
Expression profile
Description

RT-PCR-ELISA
Experimental conditions
Primer_f GGCACCAAGTTCATAATAGAG
Primer_r CTGAGCTGAGGATAAATCGTG
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 18
Experimental conditions
Panel name GeneBridge 4
Primer_f GGCACCAAGTTCATAATAGAG
Primer_r CTGAGCTGAGGATAAATCGTG
PCR product length 141 bp
PCR conditions 95 °C15 sec62 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp