KIAA1330

Product ID	ORK04088
Accession No	AB037751
Description	alpha-kinase 3
Clone name	fh15188
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5577 bp) Predicted protein sequence (945 aa)
Source	Human fetal brain
Rouge ID	mKIAA1330 by Kazusa Mouse cDNA Project

Length: 5577 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	2737 bp
Genome contig ID	gi51511731f_83101252
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- GGTGAGTGAACATATCAATAAAGACAACCTGAACC
Flanking genome sequence (116460 - 116509)	----+--------+--------+--------+--------+----* AAAATTATATCTTGGTCATACAGCCTTTAAAAGGTCCACCACAGACTGCG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	15	f	83201252	83217710	10	99.3	Perfect prediction

Length: 945 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q96L96	0	100.0	Alpha-protein k...	Homo sapiens
EAX01960	0	99.9	alpha-kinase 3 ...	Homo sapiens
NP_065829	0	99.9	alpha-kinase 3 ...	Homo sapiens
XP_001498391	0	83.9	alpha-kinase 3 ...	Equus caballus
XP_536201	4.4e-185	79.3	similar to alph...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR004166	659	857	PF02816	MHCK/EF2 kinase
HMMSmart	IPR004166	660	857	SM00811	MHCK/EF2 kinase
ProfileScan	IPR007110	514	602	PS50835	Immunoglobulin-like
ProfileScan	IPR004166	630	865	PS51158	MHCK/EF2 kinase

Primer_f	ATACCCAGGTGAGGAACAGAC
Primer_r	TTCAGTATGGAGTGCAAGGTC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-