Gene/Protein Characteristic Table for KIAA1331
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK00214
Accession No AB037752
Description SUMO1/sentrin/SMT3 specific peptidase 2
Clone name fh15253s1
Vector information
The cDNA fragment was originally inserted at SalI-NotI site ...
cDNA sequence DNA sequence (5803 bp)
Predicted protein sequence (589 aa)
Flexi ORF Clone FXC00214
Source Human fetal brain
Rouge ID mKIAA1331 by Kazusa Mouse cDNA Project
Note We replaced fh15253, former representative clones for KIAA1331 with fh15253s1. (2002/5/10)
Features of the cloned cDNA sequence
Description

Length: 5803 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq Warning No warning
Features of the protein sequence
Description

Length: 589 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAB55222 0 99.8 unnamed protein...
Homo sapiens
Q9HC62 0 99.8 Sentrin-specifi...
Homo sapiens
BAG65236 0 99.8 unnamed protein...
Homo sapiens
AAG15309 0 99.8 sentrin-specifi...
Homo sapiens
CAD39043 0 100.0 hypothetical pr...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR003653 395 587 PF02902 Peptidase C48
ProfileScan IPR003653 395 559 PS50600 Peptidase C48
Expression profile
Description

RT-PCR-ELISA
Experimental conditions
Primer_f GTTCAGCGTATTCATTCACTC
Primer_r GTGGCAGCTTGAGTAACATTC
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 3
Experimental conditions
Panel name unigene
Primer_f -
Primer_r -
PCR product length -
PCR conditions -
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp