KIAA0582

Product ID	ORK00567
Accession No	AB011154
Description	centrosomal protein 68kDa
Clone name	fh15957
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5857 bp) Predicted protein sequence (760 aa)
HaloTag ORF Clone	FHC00567
Flexi ORF Clone	FXC00567
Source	Human fetal brain
Rouge ID	mKIAA0582 by Kazusa Mouse cDNA Project
Note	We replaced hj00648, former representative clones for KIAA0582 with fh15957. (2002/5/10)

Length: 5857 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	Warning

Integrity of 3' end

Length of 3'UTR	3369 bp
Genome contig ID	gi89161199f_65036999
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- GCCTGTTTAGTGAAAAATAAAAATTAAAAAAACCT
Flanking genome sequence (130644 - 130693)	----+--------+--------+--------+--------+----* ATTCATTTTTGGCTTGTGTTTAGCTTAAATTTTATCATTAAATTAAGGAG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	2	f	65136999	65167641	7	99.4	Perfect prediction

Length: 760 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q76N32	100.0	Centrosomal pro...	Homo sapiens
Q5RCQ2	95.0	Centrosomal pro...	Pongo abelii
BAG65012	99.7	unnamed protein...	Homo sapiens
BAG62760	97.9	unnamed protein...	Homo sapiens
AAH30534	98.6	CEP68 protein [...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Primer_f	ACGGCATGGCATCACAGTATC
Primer_r	GCAACTGACAAATTCCTGAAG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Chromosome No. 2

Experimental conditions

Panel name	GeneBridge 4
Primer_f	ACGGCATGGCATCACAGTATC
Primer_r	GCAACTGACAAATTCCTGAAG
PCR product length	173 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles