KIAA1552

Product ID	ORK00862
Accession No	AB046772
Description	FLYWCH-type zinc finger 1, transcript variant 1
Clone name	fh16875
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4963 bp) Predicted protein sequence (726 aa)
HaloTag ORF Clone	FHC00862
Flexi ORF Clone	FXC00862
Source	Human fetal brain
Rouge ID	mKIAA1552 by Kazusa Mouse cDNA Project

Length: 4963 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	2472 bp
Genome contig ID	gi51511732f_2804177
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- ATCTCATGAAATTTAAAATAAATCCCCAAGGCATC
Flanking genome sequence (137026 - 137075)	----+--------+--------+--------+--------+----* AGAAACGTATCAACTAAGAACTCTAAGTTTGAAAATGGGGGTGGGGCAGT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	16	f	2902001	2941201	10	99.9	Perfect prediction

Length: 726 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAW85450	100.0	FLYWCH-type zin...	Homo sapiens
Q4VC44	99.9	FLYWCH-type zin...	Homo sapiens
AAH28572	99.7	FLYWCH-type zin...	Homo sapiens
NP_065963	100.0	FLYWCH-type zin...	Homo sapiens
EAW85454	99.9	FLYWCH-type zin...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR007588	126	184	PF04500	Zinc finger
	IPR007588	283	341	PF04500	Zinc finger
	IPR007588	431	489	PF04500	Zinc finger
	IPR007588	519	577	PF04500	Zinc finger
	IPR007588	610	668	PF04500	Zinc finger

Primer_f	TGAAGGACGGAACCACTGCAC
Primer_r	ATCTTGGTCGGAGGCTGTGAG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-