KIAA1553

Product ID	ORK05675
Accession No	AB046773
Description	BEN domain containing 3
Clone name	fh17011
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5538 bp) Predicted protein sequence (670 aa)
Source	Human fetal brain
Rouge ID	mKIAA1553 by Kazusa Mouse cDNA Project

Length: 5538 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	3524 bp
Genome contig ID	gi89161210r_107393078
PolyA signal sequence (TATAAA,-17)	+--------+--------+----*----+---- ATGAGTTATATAAAATGTTATAAAAATAGAAAAAC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATGGTCTCGTAACATGTTATTTTCTTAGAGCACTGGTCTCTCAGAATATG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	6	r	107493078	107498614	1	99.0	Perfect prediction

Length: 670 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAW48401	99.9	hCG1646472 [Hom...	Homo sapiens
XP_527466	99.7	similar to RP11...	Pan troglodytes
XP_001091339	99.4	hypothetical pr...	Macaca mulatta
XP_001504004	97.5	hypothetical pr...	Equus caballus
XP_603724	96.7	hypothetical pr...	Bos taurus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Primer_f	AGGCGAGAACACTGGATGATG
Primer_r	ACAAGAAGCCAAAAGCCCCTG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Chromosome No. 6

Experimental conditions

Panel name	CCR
Primer_f	AGGCGAGAACACTGGATGATG
Primer_r	ACAAGAAGCCAAAAGCCCCTG
PCR product length	178 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles