KIAA1557

Gene/Protein Characteristic Table for KIAA1557

Order Kazusa clone(s) from :

Product ID	ORK04169
Accession No	AB046777
Description	AT rich interactive domain 2 (ARID, RFX-like)
Clone name	fh18848
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5379 bp) Predicted protein sequence (806 aa)
Source	Human fetal brain
Rouge ID	mKIAA1557 by Kazusa Mouse cDNA Project

Features of the cloned cDNA sequence

Description

Length: 5379 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	2958 bp
Genome contig ID	gi89161190f_44431261
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- AACCATGAAATGACAATAAAATGATTTTTAAAATG
Flanking genome sequence (156827 - 156876)	----+--------+--------+--------+--------+----* AGAATGTTTTGGATAAGTGACTTCTGTCCTGATCTTAACCACTGCTGTTA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	12	f	44531261	44588086	7	100.0	Perfect prediction

Features of the protein sequence

Description

Length: 806 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAH90062	100.0	ARID2 protein [...	Homo sapiens
Q68CP9	100.0	AT-rich interac...	Homo sapiens
AAZ74794	100.0	zipzap protein ...	Homo sapiens
BAC87171	99.9	unnamed protein...	Homo sapiens
CAD97878	99.5	hypothetical pr...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
ScanRegExp	IPR007087	605	628	PS00028	Zinc finger

Expression profile

Description

RT-PCR-ELISA

Experimental conditions

Primer_f	GTTGTGGAATTTATGCTTGGC
Primer_r	ATGATGTCAACTACCAGGTGC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information

Description

Chromosome No. 12

Experimental conditions

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-

Order Kazusa clone(s) from :

Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp