KIAA1678

Product ID	ORK05700
Accession No	AB051465
Description	SPHK1 interactor, AKAP domain containing
Clone name	fh20705
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5670 bp) Predicted protein sequence (1302 aa)
Source	Human fetal brain
Rouge ID	mKIAA1678 by Kazusa Mouse cDNA Project

Length: 5670 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	1759 bp
Genome contig ID	gi89161199r_228452918
PolyA signal sequence (AATAAA,-17)	+--------+--------+----*----+---- TAACATTGCAAATTAATCAATAAATCTCTGTTGTC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AGATTGTTGATTATTTTTTCTGGAAGAGCTTTAAGCACCTCATAGAAAAA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	2	r	228552918	228592708	5	99.4	Perfect prediction

Length: 1302 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAW70886	99.8	hCG1644232, iso...	Homo sapiens
NP_085126	99.8	sphingosine kin...	Homo sapiens
CAH18317	99.7	hypothetical pr...	Homo sapiens
EAW70885	99.5	hCG1644232, iso...	Homo sapiens
XP_001137938	98.8	hypothetical pr...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB014529	2.8e-06	22.8	KIAA0629

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR008382	1226	1301	PF05716	A-kinase anchor 110 kDa

Primer_f	CCTGACTCGTAGATATTAGCC
Primer_r	CCGTGTAGGTCATTTAGTTGG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-