KIAA1570

Product ID	ORK04436
Accession No	AB046790
Description	cancer susceptibility candidate 5
Clone name	fh22947
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5584 bp) Predicted protein sequence (1360 aa)
Source	Human fetal brain
Rouge ID	mKIAA1570 by Kazusa Mouse cDNA Project

Length: 5584 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	1500 bp
Genome contig ID	gi51511731f_38602622
PolyA signal sequence (ATTAAA,-22)	+--------+--------+----*----+---- TACATTTTGCACTATTAAAATAAGTTTATTACTTT
Flanking genome sequence (141209 - 141258)	----+--------+--------+--------+--------+----* AAATCTTTTGTGAGTAGTGTTTCTTTATAAAGAATATTTTAGCATTTATC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	15	f	38702622	38743829	18	99.4	Perfect prediction

Length: 1360 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAL67803	100.0	AF15q14 isoform...	Homo sapiens
NP_653091	100.0	cancer suscepti...	Homo sapiens
NP_733468	100.0	cancer suscepti...	Homo sapiens
Q8NG31	100.0	Protein CASC5; ...	Homo sapiens
AAM45143	100.0	AF15q14 [Homo s...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Primer_f	AAGAAGATCGATAACTGCCTC
Primer_r	GTCTGCTCTTTTTGTACCTCC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Chromosome No. 15

Experimental conditions

Panel name	CCR
Primer_f	ATCACTTAGAAACTCAGCCGG
Primer_r	TGGTATGTCTCAATCAAGGCC
PCR product length	184 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles