KIAA1239

Product ID	ORK05644
Accession No	AB033065
Description	NACHT and WD repeat domain containing 2
Clone name	fh23104
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5742 bp) Predicted protein sequence (1164 aa)
Source	Human fetal brain
Rouge ID	mKIAA1239 by Kazusa Mouse cDNA Project
Note	We replaced fh10348, former representative clones for KIAA1239 with fh23104. (2002/5/10)

Length: 5742 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	2245 bp
Genome contig ID	gi89161207f_37021738
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- ATGTATTATTTGTATGAATAAAAGATAAACTACTT
Flanking genome sequence (105743 - 105792)	----+--------+--------+--------+--------+----* AGATTGGCGTGCTGTTTTTCTCCCCCATTTTTGGCAGATGTGATTAGAGA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	4	f	37121738	37127479	1	100.0	Perfect prediction

Length: 1164 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAW92881	100.0	hCG1643124 [Hom...	Homo sapiens
XP_001137884	99.7	hypothetical pr...	Pan troglodytes
XP_001091217	98.6	similar to T05C...	Macaca mulatta
XP_545955	96.7	similar to T05C...	Canis lupus fam...
XP_587308	96.1	similar to mCG9...	Bos taurus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMSmart	IPR001680	361	417	SM00320	WD40 repeat
	IPR001680	420	459	SM00320	WD40 repeat
	IPR001680	685	724	SM00320	WD40 repeat
	IPR001680	769	807	SM00320	WD40 repeat
	IPR001680	808	847	SM00320	WD40 repeat
ProfileScan	IPR001680	385	468	PS50294	WD40 repeat
ProfileScan	IPR001680	649	856	PS50294	WD40 repeat
ScanRegExp	IPR001680	404	418	PS00678	WD40 repeat

Primer_f	GCAAACCACATACAGATCACC
Primer_r	TGTGGCATGGAGGTTCAACTG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-