KIAA0563

Product ID	ORK00098
Accession No	AB011135
Description	leucine rich repeat containing 37, member A3, transcript variant 1
Clone name	fh23589
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5665 bp) Predicted protein sequence (1652 aa)
HaloTag ORF Clone	FHC00098
Flexi ORF Clone	FXC00098
Source	Human fetal brain
Note	We replaced hh01806, former representative clones for KIAA0563 with fh23589. (2005/08/06)

Length: 5665 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	Warning

Integrity of 3' end

Length of 3'UTR	229 bp
Genome contig ID	gi51511734r_60180950
PolyA signal sequence (ATTAAA,-22)	+--------+--------+----*----+---- TGGAGATTTTACAATTAAATAACATTGTTTTTGGT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* GCCCTCTCCCTTGGTTCATCAAGCACCAGTCATATAATACCACATACTTG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	17	r	60280950	60345365	14	99.7	Perfect prediction
Ensembl gnome browser	17	f	41705170	41770901	14	98.1	Terminal No-hit
Ensembl gnome browser	17	f	41923846	41988315	14	98.2	Terminal No-hit

Length: 1652 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
O60309	100.0	Leucine-rich re...	Homo sapiens
AAH43145	99.8	Leucine rich re...	Homo sapiens
A6NM11	97.5	Leucine-rich re...	Homo sapiens
A6NMS7	97.4	Leucine-rich re...	Homo sapiens
AAH40501	97.0	Leucine rich re...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
D79992	0.00067	22.8	KIAA0170

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001611	933	946	PR00019	Leucine-rich repeat
FPrintScan	IPR001611	954	967	PR00019	Leucine-rich repeat
HMMPfam	IPR001611	932	954	PF00560	Leucine-rich repeat
	IPR001611	956	978	PF00560	Leucine-rich repeat
	IPR001611	983	1005	PF00560	Leucine-rich repeat
HMMSmart	IPR003591	910	929	SM00369	Leucine-rich repeat
	IPR003591	930	953	SM00369	Leucine-rich repeat
	IPR003591	954	977	SM00369	Leucine-rich repeat
	IPR003591	981	1005	SM00369	Leucine-rich repeat

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	29	CVMSPLRFWGPWPLLMWQLLWLL	51	SECONDARY	23
SOSUI2	2	1600	LILALIVTGILTILIILLCLIEI	1622	PRIMARY	23

Panel name
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-