Order Kazusa clone(s) from : ![]() |
Product ID | ORK07133 |
---|---|
Accession No | AB051477 |
Description | transmembrane protein 108 |
Clone name | fh27434 |
Vector information | |
cDNA sequence | DNA sequence (4835 bp) Predicted protein sequence (482 aa) |
Source | Human fetal brain |
Rouge ID |
mKIAA1690
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 3245 bp |
---|---|
Genome contig ID | gi89161205f_134226607 |
PolyA signal sequence (None) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (364612 - 364661) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 3 | f | 134430790 | 134591217 | 3 | 98.9 | Terminal No-hit |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
ScanRegExp | IPR010916 | 1 | 37 | PS00430 | TonB box |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 3 | YCQLLSFLLILALTEALAFAIQE | 25 | PRIMARY | 23 | 2 | 455 | TICLSKMDIAWVILAISVPISSC | 477 | PRIMARY | 23 |
---|
![]() |
Primer_f | TTGGCTTCAGCTCTCCTCATC |
---|---|
Primer_r | CACACTGCAGAAGGGTAACAC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | CCR |
---|---|
Primer_f | TTGGCTTCAGCTCTCCTCATC |
Primer_r | CACACTGCAGAAGGGTAACAC |
PCR product length | 136 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |