Order Kazusa clone(s) from :
Japan
||
Other countries |
Product ID | ORK00808 |
---|---|
Accession No | AB037765 |
Description | thioredoxin domain containing 16, transcript variant 1 |
Clone name | fj00476s1 |
Vector information | |
cDNA sequence | DNA sequence (4552 bp) Predicted protein sequence (858 aa) |
HaloTag ORF Clone |
FHC00808
|
Flexi ORF Clone | FXC00808 |
Source | Human fetal brain |
Rouge ID |
mKIAA1344
by Kazusa Mouse cDNA Project
|
Note | We replaced fj00476, former representative clones for KIAA1344 with fj00476s1. (2002/5/10) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 1713 bp |
---|---|
Genome contig ID | gi51511730r_51867059 |
PolyA signal sequence (AATAAA,-30) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 14 | r | 51967059 | 52088963 | 21 | 99.4 | Perfect prediction |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.Result of homology search against HUGE database (FASTA output, Multiple alignment)
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR013766 | 425 | 528 | PF00085 | Thioredoxin domain |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 31 | QLIMFSGFNVFRVGISFVIMCIF | 53 | PRIMARY | 23 | 2 | 151 | TLFDVNAIVAHVLFALLFSEVKY | 173 | PRIMARY | 23 |
---|
RT-PCR-ELISA |
Primer_f | CTTGTTTTGGTGAATCTGCAT |
---|---|
Primer_r | AATCATAAGCTGGAAGAGGAG |
PCR conditions | 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles |
Panel name | unigene |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |