KIAA1345

Gene/Protein Characteristic Table for KIAA1345

Order Kazusa clone(s) from :

Product ID	ORK00809
Accession No	AB037766
Description	coiled-coil and C2 domain containing 2A
Clone name	fj00488
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4790 bp) Predicted protein sequence (1532 aa)
HaloTag ORF Clone	FHC00809
Flexi ORF Clone	FXC00809
Source	Human fetal brain

Features of the cloned cDNA sequence

Description

Length: 4790 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	121 bp
Genome contig ID	gi89161207f_14989945
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- CATATTATTGGCAAATAATAAAATTATCAACTGTT
Flanking genome sequence (222324 - 222373)	----+--------+--------+--------+--------+----* TTCAAACTGTGCAAAGTGTTCTATTTAGCAGTCTGCCTTGTGTCTGCTAC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	4	f	15089945	15212267	34	99.9	Perfect prediction

Features of the protein sequence

Description

Length: 1532 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9P2K1	99.9	Coiled-coil and...	Homo sapiens
EAW92732	99.9	hCG40571, isofo...	Homo sapiens
XP_001118936	96.8	similar to CG18...	Macaca mulatta
XP_001500688	89.3	coiled-coil and...	Equus caballus
XP_595408	84.9	similar to coil...	Bos taurus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMSmart	IPR000008	1013	1173	SM00239	C2 calcium-dependent membrane targeting

Expression profile

Description

RT-PCR-ELISA

Experimental conditions

Primer_f	AGTGAAGCCTTTAATTGACGC
Primer_r	GCAACATAGATCCAAACAGAC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information

Description

Chromosome No. 4

Experimental conditions

Panel name	genbank
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-

Order Kazusa clone(s) from :

Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp