KIAA1537

Product ID	ORK00857
Accession No	AB040970
Description	RUN and FYVE domain containing 2
Clone name	fj02581s1
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pYO326GW (Amp-r) vector. The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector. The original pYO326 shuttle vector (Amp-r) was kindly provided by Y. Ohya (University of Tokyo).
cDNA sequence	DNA sequence (2110 bp) Predicted protein sequence (619 aa)
HaloTag ORF Clone	FHC00857
Flexi ORF Clone	FXC00857
Source	Human fetal brain
Rouge ID	mKIAA1537 by Kazusa Mouse cDNA Project
Note	We replaced fj02581, former representative clones for KIAA1537 with fj02581s1. (2002/5/10)

Length: 2110 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	248 bp
Genome contig ID	gi89161187r_69670870
PolyA signal sequence (ATTAAA,-26)	+--------+--------+----*----+---- ATTGAGAATATTAAAGTAAATTACCACATACCTTG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATTTTTCCTCATCAATTAAAACAAACCCTTCCACTGCCCTGTCAGACTAA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	10	r	69770870	69836713	19	99.9	Perfect prediction

Length: 619 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q8WXA3	6.8e-181	100.0	RUN and FYVE do...	Homo sapiens
EAW54294	1.9e-176	98.1	RUN and FYVE do...	Homo sapiens
AAL67520	3.9e-176	100.0	RUFY2 [Homo sap...	Homo sapiens
Q5R5R4	8.4e-176	99.7	RUN and FYVE do...	Pongo abelii
XP_001503659	4e-175	98.4	RUN and FYVE do...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB020678	6.5e-28	62.9	KIAA0871

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR004012	58	182	PF02759	RUN
HMMPfam	IPR000306	548	612	PF01363	Zinc finger
HMMSmart	IPR004012	118	180	SM00593	RUN
HMMSmart	IPR000306	545	612	SM00064	Zinc finger
ProfileScan	IPR004012	50	182	PS50826	RUN
ProfileScan	IPR000306	553	611	PS50178	Zinc finger

Primer_f	TGGAAGCTGAAGATGAGGATG
Primer_r	AGTCTGCCTCCATTCCTTCTC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-