Gene/Protein Characteristic Table for KIAA1367
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK04619
Accession No AB037788
Description cleavage and polyadenylation specific factor 2, 100kDa
Clone name fj03001
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (4196 bp)
Predicted protein sequence (579 aa)
Source Human fetal brain
Rouge ID mKIAA1367 by Kazusa Mouse cDNA Project
Features of the cloned cDNA sequence
Description

Length: 4196 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq Warning No warning
Features of the protein sequence
Description

Length: 579 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAG51207 0 100.0 unnamed protein...
Homo sapiens
Q9P2I0 0 100.0 Cleavage and po...
Homo sapiens
BAE00542 0 99.8 unnamed protein...
Macaca fascicularis
XP_001092942 0 99.8 similar to clea...
Macaca mulatta
Q10568 0 99.5 Cleavage and po...
Bos taurus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR011108 324 366 PF07521 RNA-metabolising metallo-beta-lactamase
Expression profile
Description

RT-PCR-ELISA
Experimental conditions
Primer_f ACTCACTTGTCAGCTCTCTTC
Primer_r TATAACGCTAGAATCTGAGGG
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 14
Experimental conditions
Panel name unigene
Primer_f -
Primer_r -
PCR product length -
PCR conditions -
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp