KIAA1474

Product ID	ORK07227
Accession No	AB040907
Description	teashirt zinc finger homeobox 3
Clone name	fj03364
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (3692 bp) Predicted protein sequence (1079 aa)
Source	Human fetal brain
Rouge ID	mKIAA1474 by Kazusa Mouse cDNA Project

Length: 3692 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	450 bp
Genome contig ID	gi42406306r_36358872
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- TTTGGTTAAAAAATAAAATAAAATAATAATAATGT
Flanking genome sequence (99971 - 99922)	----+--------+--------+--------+--------+----* ATGAAGCTCTGTTTTTTAAACTCCTTACCAGCTTAGTTATAATGAATAAT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	19	r	36458843	36531961	2	99.0	Perfect prediction

Length: 1079 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q63HK5	100.0	Teashirt homolo...	Homo sapiens
CAH56184	99.9	hypothetical pr...	Homo sapiens
BAF84155	99.8	unnamed protein...	Homo sapiens
XP_001103809	99.4	similar to teas...	Macaca mulatta
XP_512561	99.9	hypothetical pr...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR007087	212	236	PF00096	Zinc finger
	IPR007087	273	297	PF00096	Zinc finger
	IPR001356	890	957	PF00046	Homeobox
	IPR007087	1039	1062	PF00096	Zinc finger
HMMSmart	IPR015880	212	236	SM00355	Zinc finger
	IPR015880	273	297	SM00355	Zinc finger
	IPR015880	384	408	SM00355	Zinc finger
	IPR001356	888	962	SM00389	Homeobox
	IPR015880	974	996	SM00355	Zinc finger
	IPR015880	1039	1062	SM00355	Zinc finger
ProfileScan	IPR007087	273	302	PS50157	Zinc finger
	IPR001356	887	958	PS50071	Homeobox
	IPR007087	1039	1067	PS50157	Zinc finger
ScanRegExp	IPR007087	214	236	PS00028	Zinc finger
	IPR007087	275	297	PS00028	Zinc finger
	IPR007087	976	996	PS00028	Zinc finger
	IPR007087	1041	1062	PS00028	Zinc finger

Primer_f	TCCAATACACCTGCCAGCATC
Primer_r	GGTATTTGGAAGAGATGTCAC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	TCCAATACACCTGCCAGCATC
Primer_r	GGTATTTGGAAGAGATGTCAC
PCR product length	148 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles