Order Kazusa clone(s) from : ![]() |
Product ID | ORK07227 |
---|---|
Accession No | AB040907 |
Description | teashirt zinc finger homeobox 3 |
Clone name | fj03364 |
Vector information | |
cDNA sequence | DNA sequence (3692 bp) Predicted protein sequence (1079 aa) |
Source | Human fetal brain |
Rouge ID |
mKIAA1474
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 450 bp |
---|---|
Genome contig ID | gi42406306r_36358872 |
PolyA signal sequence (AATAAA,-19) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (99971 - 99922) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 19 | r | 36458843 | 36531961 | 2 | 99.0 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR007087 | 212 | 236 | PF00096 | Zinc finger |
IPR007087 | 273 | 297 | PF00096 | Zinc finger | |
IPR001356 | 890 | 957 | PF00046 | Homeobox | |
IPR007087 | 1039 | 1062 | PF00096 | Zinc finger | |
HMMSmart | IPR015880 | 212 | 236 | SM00355 | Zinc finger |
IPR015880 | 273 | 297 | SM00355 | Zinc finger | |
IPR015880 | 384 | 408 | SM00355 | Zinc finger | |
IPR001356 | 888 | 962 | SM00389 | Homeobox | |
IPR015880 | 974 | 996 | SM00355 | Zinc finger | |
IPR015880 | 1039 | 1062 | SM00355 | Zinc finger | |
ProfileScan | IPR007087 | 273 | 302 | PS50157 | Zinc finger |
IPR001356 | 887 | 958 | PS50071 | Homeobox | |
IPR007087 | 1039 | 1067 | PS50157 | Zinc finger | |
ScanRegExp | IPR007087 | 214 | 236 | PS00028 | Zinc finger |
IPR007087 | 275 | 297 | PS00028 | Zinc finger | |
IPR007087 | 976 | 996 | PS00028 | Zinc finger | |
IPR007087 | 1041 | 1062 | PS00028 | Zinc finger |
![]() |
Primer_f | TCCAATACACCTGCCAGCATC |
---|---|
Primer_r | GGTATTTGGAAGAGATGTCAC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | TCCAATACACCTGCCAGCATC |
Primer_r | GGTATTTGGAAGAGATGTCAC |
PCR product length | 148 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |