KIAA1386

Product ID	ORK01163
Accession No	AB037807
Description	ankyrin repeat and IBR domain containing 1
Clone name	fj06274
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4030 bp) Predicted protein sequence (1214 aa)
HaloTag ORF Clone	FHC01163
Flexi ORF Clone	FXC01163
Source	Human fetal brain
Rouge ID	mKIAA1386 by Kazusa Mouse cDNA Project

Length: 4030 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	384 bp
Genome contig ID	gi89161213f_91613484
PolyA signal sequence (None)	+--------+--------+----*----+---- AGGCTTACTCCCTAATCTTTGGGTGGCTTTCCTTT
Flanking genome sequence (253101 - 253150)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAAGTTTTCTTCATTCTAGAAATTTATTTTGGATAAAT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	7	f	91713484	91866583	20	99.7	Perfect prediction

Length: 1214 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_519196	99.7	ankyrin repeat ...	Pan troglodytes
AAH63861	99.9	ANKIB1 protein ...	Homo sapiens
BAG11319	100.0	ankyrin repeat ...	synthetic construct
Q9P2G1	99.9	Ankyrin repeat ...	Homo sapiens
XP_850019	96.4	similar to Anky...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB014608	1.6e-06	26.0	KIAA0708

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR002110	171	183	PR01415	Ankyrin
FPrintScan	IPR002110	282	294	PR01415	Ankyrin
HMMPfam	IPR002110	170	202	PF00023	Ankyrin
	IPR002110	269	301	PF00023	Ankyrin
	IPR002867	527	603	PF01485	Zinc finger
	IPR002867	643	677	PF01485	Zinc finger
	IPR003903	975	992	PF02809	Ubiquitin interacting motif
HMMSmart	IPR002110	170	199	SM00248	Ankyrin
	IPR002110	269	298	SM00248	Ankyrin
	IPR001841	458	506	SM00184	Zinc finger
	IPR002867	527	603	SM00647	Zinc finger
	IPR002867	626	690	SM00647	Zinc finger
	IPR001841	644	768	SM00184	Zinc finger
ProfileScan	IPR002110	170	202	PS50088	Ankyrin
	IPR002110	170	322	PS50297	Ankyrin
	IPR002110	269	301	PS50088	Ankyrin
	IPR001841	458	504	PS50089	Zinc finger
	IPR003903	976	995	PS50330	Ubiquitin interacting motif

Primer_f	ACAGAGGAGATGGTTCAGATG
Primer_r	ATCAAGCATACTCCACCTAGC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-