KIAA1585

Gene/Protein Characteristic Table for KIAA1585

Order Kazusa clone(s) from :

Product ID	ORK00870
Accession No	AB046805
Description	male-specific lethal 2 homolog (Drosophila), transcript variant 1
Clone name	fj07340
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4039 bp) Predicted protein sequence (595 aa)
HaloTag ORF Clone	FHC00870
Flexi ORF Clone	FXC00870
Source	Human fetal brain
Rouge ID	mKIAA1585 by Kazusa Mouse cDNA Project

Features of the cloned cDNA sequence

Description

Length: 4039 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	2224 bp
Genome contig ID	gi89161205r_137250450
PolyA signal sequence (AATAAA,-24)	+--------+--------+----*----+---- TTAAATCTATCAATAAATGATAGTTTTCTAATTCT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATGTTGTAGAATACTGAAGAGTTTGGGATAGCATGCTCTGAATGGTCTGT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	3	r	137350450	137396726	2	99.1	Perfect prediction

Features of the protein sequence

Description

Length: 595 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_542793	98.8	similar to ring...	Canis lupus fam...
XP_236567	98.5	similar to ring...	Rattus norvegicus
Q9HCI7	100.0	Male-specific l...	Homo sapiens
BAF85246	99.7	unnamed protein...	Homo sapiens
XP_001927797	99.1	similar to Male...	Sus scrofa

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
ProfileScan	IPR001841	62	103	PS50089	Zinc finger

Expression profile

Description

RT-PCR-ELISA

Experimental conditions

Primer_f	AAGGACTGACTAGGTGTAATG
Primer_r	GGCGAGTAACCATCATTGAAC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information

Description

Chromosome No. 3

Experimental conditions

Panel name	RH-map
Primer_f	AAGGACTGACTAGGTGTAATG
Primer_r	GGCGAGTAACCATCATTGAAC
PCR product length	194 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles

Order Kazusa clone(s) from :

Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp