|
Order Kazusa clone(s) from : |
| Product ID | ORK00870 |
|---|---|
| Accession No | AB046805 |
| Description | male-specific lethal 2 homolog (Drosophila), transcript variant 1 |
| Clone name | fj07340 |
| Vector information | |
| cDNA sequence | DNA sequence (4039 bp) Predicted protein sequence (595 aa) |
|
HaloTag ORF Clone |
FHC00870
|
| Flexi ORF Clone | FXC00870 |
| Source | Human fetal brain |
| Rouge ID |
mKIAA1585
by Kazusa Mouse cDNA Project
|
Length: 4039 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).
| N-terminal truncation | Coding interruption | |
|---|---|---|
| cloned DNA seq | No warning | No warning |
Integrity of 3' end
| Length of 3'UTR | 2224 bp |
|---|---|
| Genome contig ID | gi89161205r_137250450 |
| PolyA signal sequence (AATAAA,-24) |
+----*----+----*----+----*----+---- |
| Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
| Chr | f/r | start | end | exon | identity | class | |
|---|---|---|---|---|---|---|---|
|
| 3 | r | 137350450 | 137396726 | 2 | 99.1 | Perfect prediction |
Length: 595 aa
Result of homology search against nr database
(FASTA output,
Multiple alignment)![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database
(FASTA output,
Multiple alignment)
Result of motif / domain search (InterProScan and SOSUI)
Result of InterProScan
| Search method | interpro_ID | From | To | Entry | Definition |
|---|---|---|---|---|---|
| ProfileScan | IPR001841 | 62 | 103 | PS50089 | Zinc finger |
RT-PCR-ELISA
|
Experimental conditions| Primer_f | AAGGACTGACTAGGTGTAATG |
|---|---|
| Primer_r | GGCGAGTAACCATCATTGAAC |
| PCR conditions | 95 °C 30 sec 55 °C 30 sec 72 °C 60 sec 30 cycles![]() |
Chromosome No. 3
Experimental conditions| Panel name | RH-map |
|---|---|
| Primer_f | AAGGACTGACTAGGTGTAATG |
| Primer_r | GGCGAGTAACCATCATTGAAC |
| PCR product length | 194 bp |
| PCR conditions | 95 °C 15 sec 62 °C 60 sec 30 cycles |