KIAA1694

Gene/Protein Characteristic Table for KIAA1694

Order Kazusa clone(s) from :

Product ID	ORK05703
Accession No	AB051481
Description	c-Maf inducing protein
Clone name	fj11293
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4235 bp) Predicted protein sequence (757 aa)
Source	Human fetal brain
Rouge ID	mKIAA1694 by Kazusa Mouse cDNA Project

Features of the cloned cDNA sequence

Description

Length: 4235 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	1960 bp
Genome contig ID	gi51511732f_79936395
PolyA signal sequence (AATAAA,-22)	+--------+--------+----*----+---- ACTTTCAGGCAAAAATAAACTGTAAGTGACTCATC
Flanking genome sequence (366473 - 366522)	----+--------+--------+--------+--------+----* AATGTCTGGCCTTTGTGTGGTTTCTCGGCGCCCAGCGGGAGAAGGTCCAA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	16	f	80036395	80302866	21	99.5	Perfect prediction

Features of the protein sequence

Description

Length: 757 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG72498	100.0	c-Maf-inducing ...	synthetic construct
XP_214698	98.5	similar to c-Ma...	Rattus norvegicus
XP_001004724	98.4	hypothetical pr...	Mus musculus
Q8IY22	100.0	C-Maf-inducing ...	Homo sapiens
Q9D486	98.8	C-Maf-inducing ...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
ScanRegExp	IPR001680	94	108	PS00678	WD40 repeat

Expression profile

Description

RT-PCR-ELISA

Experimental conditions

Primer_f	ACGTGGAAATCCTCAAGCTGC
Primer_r	GCGAACCTCTGAATCACGTAC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information

Description

Chromosome No. 16

Experimental conditions

Panel name	CCR
Primer_f	CAGCTGACACCTACGAAGATC
Primer_r	GCTCTGCGGCTGTTAGTCAAG
PCR product length	150 bp
PCR conditions	95 °C15 sec66 °C60 sec30 cycles

Order Kazusa clone(s) from :

Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp