Gene/Protein Characteristic Table for KIAA1694
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK05703
Accession No AB051481
Description c-Maf inducing protein
Clone name fj11293
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (4235 bp)
Predicted protein sequence (757 aa)
Source Human fetal brain
Rouge ID mKIAA1694 by Kazusa Mouse cDNA Project
Features of the cloned cDNA sequence
Description

Length: 4235 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq Warning No warning
Integrity of 3' end
Length of 3'UTR 1960 bp
Genome contig ID gi51511732f_79936395
PolyA signal sequence
(AATAAA,-22)
+----*----+----*----+----*----+----
ACTTTCAGGCAAAAATAAACTGTAAGTGACTCATC
Flanking genome sequence
(366473 - 366522)
----+----*----+----*----+----*----+----*----+----*
AATGTCTGGCCTTTGTGTGGTTTCTCGGCGCCCAGCGGGAGAAGGTCCAA

Ensembl ContigView (Add our DAS server as a DAS source)


Chr f/r start end exon identity class
Ensembl gnome browser 16 f 80036395 80302866 21 99.5 Perfect prediction
Features of the protein sequence
Description

Length: 757 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAG72498 0 100.0 c-Maf-inducing ...
synthetic construct
XP_214698 0 98.5 similar to c-Ma...
Rattus norvegicus
XP_001004724 0 98.4 hypothetical pr...
Mus musculus
Q8IY22 0 100.0 C-Maf-inducing ...
Homo sapiens
Q9D486 0 98.8 C-Maf-inducing ...
Mus musculus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
ScanRegExp IPR001680 94 108 PS00678 WD40 repeat
Expression profile
Description

RT-PCR-ELISA
Experimental conditions
Primer_f ACGTGGAAATCCTCAAGCTGC
Primer_r GCGAACCTCTGAATCACGTAC
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 16
Experimental conditions
Panel name CCR
Primer_f CAGCTGACACCTACGAAGATC
Primer_r GCTCTGCGGCTGTTAGTCAAG
PCR product length 150 bp
PCR conditions 95 °C15 sec66 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp