KIAA1826

Product ID	ORK00284
Accession No	AB058729
Description	Myb/SANT-like DNA-binding domain containing 4 with coiled-coils
Clone name	fj12317
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4066 bp) Predicted protein sequence (380 aa)
HaloTag ORF Clone	FHC00284
Flexi ORF Clone	FXC00284
Source	Human fetal brain

Length: 4066 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	1612 bp
Genome contig ID	gi51511727r_105283860
PolyA signal sequence (AATAAA,-24)	+--------+--------+----*----+---- TCTATATCTGAAATAAATGCTTCTACCATAGAAAT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAATTTGCCTATACTATCTGAGAATTTGTAATTTCAGATGATACTCAGTG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	11	r	105383860	105398164	3	99.5	Perfect prediction

Length: 380 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAE88732	3.5e-110	99.7	unnamed protein...	Macaca fascicularis
EDL09327	2.8e-108	89.5	RIKEN cDNA 8430...	Mus musculus
AAH84111	1.3e-41	63.2	LOC495021 prote...	Xenopus laevis
AAH76739	7.6e-37	62.0	MGC81432 protei...	Xenopus laevis
AAG44625	2.7e-28	99.0	DC25 [Homo sapi...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	6	SKELSLVFVLCSIPQIVFTSLTI	28	PRIMARY	23

Primer_f	TTGGGAAGAGATTGCACAGTG
Primer_r	AGAGAGTCATCCAAATCAGAG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-